Artículo en PDF
Cómo citar el artículo
Número completo
Más información del artículo
Página de la revista en redalyc.org
Sistema de Información Científica
Red de Revistas Científicas de América Latina y el Caribe, España y Portugal
Rev. Chil. Neuropsicol. 7(3): 115-121, 2012
www.neurociencia.cl
DOI: 10.5839/rcnp.2012.0703.04
*
Correspondencia: feggy@servidor.unam.mx. Universidad Nacional Autónoma de México, Rivera de Cupia 110-71, Lomas de Reforma, México, D.F.
11930. Teléfono: +52 (55) 2 51 76 56.
Recibido: 19-12-11. Revisión desde: 26-04-12. Aceptado: 27-05-12
ISSN 0718-4913 versión en línea
Universidad de La Frontera
Artículo de investigación
Efectos del polimorfismo Val
108/158
Met del gen dopaminérgico Catecol-O-metil
transferasa COMT en las funciones ejecutivas de preescolares
Effects of dopamine gene polymorphism Val
108/158
Met Catechol-O-methyltransferase COMT
in executive functions in preschool
Carla Sandoval
1
& Feggy Ostrosky
1*
1 Laboratorio de Psicofisiología y Neuropsicología, Facultad de Psicología, Universidad Nacional Autónoma de México. México D. F., México.
Resumen
El nivel de Dopamina en la Corteza Prefrontal se ha relacionado al desempeño de las Funciones Ejecutivas (FE). El objetivo de este estudio es
explorar el efecto del polimorfismo funcional del gen COMT (Val/Val, Val/Met y Met/Met) en las FE de preescolares. Se utilizó la Batería
Neuropsicológica de Funciones Ejecutivas para niños, y se extrajo el ADN genómico según metodología estándar (N=248) de 3 a 6 años de
edad (M=4.6). Se estudiaron las frecuencias genotípicas del gen COMT y se realizó un análisis de varianza (ANOVA one-way) estableciendo
diferencias significativas con una p<0.05. Los niños con el polimorfismo de baja actividad Met/Met puntúan significativamente mejor en
relación a los niños con polimorfismo Val/Val en pruebas que requieren de Inhibición y los niños con el polimorfismo de alta actividad
Val/Val resultan con un mejor rendimiento en pruebas relacionadas a MT, Planeación y Abstracción que los niños con polimorfismo Met/Met
y Val/Met. Estos resultados parecen reflejar el papel de la enzima COMT como regulador de DA y que tanto el hipermetabolismo como el
hipometabolismo tiene implicaciones importantes en las FE.
Palabras clave
: funciones ejecutivas, dopamina, COMT, genética, niños
Abstract
The level of DA in the prefrontal cortex has been related to the performance on executive functions (EF). The objective of this study was to
explore the effect of the COMT polymorphism (Val/Val, Val/Met, Met/Met) in the performance of EF in a population of preschool children.
All subjects were evaluated with a Neuropsychological Battery and genomic DNA was extracted according to standard methodology (N=248)
from 3 to 6 years of age (M=4.6). We studied genotypic frequencies of the COMT gene and an analysis of variance (one-way ANOVA) with
post hoc analysis, establishing significant differences at p<0.05. In Children with a low activity polymorphism Met/Met scored significantly
better in relation to the children with polymorphism Val/Val in tests requiring inhibition and children with high activity polymorphism
Val/Val had better performance on tests related to working memory, planning and abstraction that children with polymorphism Met/Met and
Val/Met. These results seem to reflect the role of COMT enzyme as a regulator of DA and that both hypermetabolism and hypometabolism
has important implications for the EF.
Keywords
: executive functions, dopamine, COMT, genetic, children
Introducción
Los factores genéticos influyen en la cantidad y la actividad de
diferentes enzimas necesarias en las vías metabólicas del orga-
nismo. La enzima COMT se encuentra en la parte inicial de la
transformación metabólica de las Catecolaminas y es codificada
por el gen COMT en el cromosoma 22q11, con una mutación
que ocasiona en la posición 150 del péptido, el reemplazo de
una guanina (G) por una adenina (A) que en la proteína se
manifiesta con la presencia de una metionina (Met) en vez de
una valina (Val), en el codón 108 (forma soluble) o el codón
158 (forma unida a la membrana); por eso la denominación
Val
108/158
Met (Nokelainen y Flint, 2002). De este gen resultan 2
alelos polimórficos (Val=Valina o G= Guanina) y (Met= Me-
tionina o A= Adenina) y da lugar a 3 genotipos: Val/Val con
una alta capacidad de degradación postsináptica del neuro-
transmisor (NT), Met/Met con un menor catabolismo del NT
(actividad enzimática cuatro veces menor que Val/Val) y el
Sandoval & Ostrosky.
Rev. Chil. Neuropsicol. 7(3):
115-121, 2012
116
alelo heterocigoto Val/Met que muestra una actividad enzimá-
tica intermedia con respecto a los alelos codominantes Val y
Met (Mannisto y Kaakkola, 1999). El gen Catecol-O-metil
transferasa (COMT) interviene de modo significativo en la
regulación del sistema dopaminérgico al determinar la actividad
de la enzima y la capacidad de degradar o inactivar las cateco-
laminas, especialmente en la Corteza Prefrontal (CPF) (Monta-
ge et al., 2008). Por lo que se ha sugerido es la principal enzima
de los mamíferos involucrada en la degradación metabólica de
la dopamina (DA) liberada en esta región (más del 60%) (Man-
nisto et al., 1999), al tener un efecto mayor que en otras regio-
nes neurales como el estriado en donde existen mas transporta-
dores de DA y se encuentran mejor situados que en la CPF, lo
que la hace particularmente dependiente de mecanismos secun-
darios como la degradación por medio de COMT para inactivar
la DA extracelular. Esta distinción de las características es im-
portante ya que proporciona el mecanismo por el cual el efecto
del polimorfismo genético afecta el metabolismo de la DA.
(Diamond, 2004).
La DA es el NT catecolaminérgico más importante del
Sistema Nervioso Central (SNC) de los mamíferos y participa
en la regulación de diversas funciones como la conducta moto-
ra, la emotividad y la afectividad así como en la comunicación
neuroendocrina. La DA se sintetiza a partir del aminoácido L-
tirosina y existen mecanismos que regulan de manera muy
precisa su síntesis y liberación. Se han identificado 5 tipos de
receptores dopaminérgicos, acoplados a proteínas G y divididos
en dos familias farmacológicas (D1 y D2) distribuidos en diver-
sas áreas del SNC donde son responsables de las diversas ac-
ciones fisiológicas de la DA (Bahena et al., 2000). El estudio de
estos sistemas y receptores dopaminérgicos del SNC ha sido de
gran interés al observarse que diversas alteraciones en los nive-
les de transmisión de la DA en la CPF se relaciona con trastor-
nos conductuales y cognitivos, en especial alteraciones en las
Funciones Ejecutivas (FE). La relación entre las FE y la CPF ha
sido señalada en diversos estudios tanto en poblaciones de
adultos como poblaciones infantiles mediante la utilización de
técnicas de neuroimágen (Stuss et al., 2000, 2002; Lie et al.,
2006; Wagner et al., 2006) y con tareas cognitivas (Diamond,
1996, 2001, 2004, 2007; Blasi et al., 2005; Krugel et al., 2009;
Lypsky et al., 2005; Barnett et al., 2007; Meyer-Linderberg et al.,
2005).
Las FE son definidas por Lezak (1987) como la capacidad
mental esencial para llevar a cabo una conducta eficaz, creativa
y socialmente aceptada, también se han descrito como las habi-
lidades cognoscitivas que nos permiten la anticipación y el
establecimiento de metas, el diseño de planes y programas, el
inicio de las actividades y de las operaciones mentales, la auto-
rregulación y la monitorización de las tareas, la selección de la
conducta, la flexibilidad en el trabajo cognoscitivo y su organi-
zación en el tiempo y en el espacio (Harris, 2005).
El objetivo principal de estas funciones de acuerdo a Co-
llette et al. (2006) es facilitar la adaptación del individuo a situa-
ciones nuevas y complejas yendo más allá de conductas habi-
tuales y automáticas; sin embargo, existe cierta controversia
sobre la naturaleza de las FE, si es unitaria (Rodriguez-Aranda
& Sudnet, 2006; Salthouse, 2005) o multifactorial (Cohen et al.,
1996; Miyake, Fredman, & Emerson 2000; Baddeley, 1990;
Anderson et al., 2001; Stuss & Levine, 2002; Diamond et al.,
2002). Mediante estudios conductuales y análisis estadísticos,
diversos investigadores como Miyake (2002) proponen que la
naturaleza de las FE es multifactorial, ya que son constructos
independientes pero moderadamente relacionados, es decir que
involucran varios procesos cognoscitivos independientes.
Estos factores o componentes principales son denomina-
dos entonces: Flexibilidad cognitiva “Shifting” (cambio entre
tareas o sets mentales), Actualización “Updating” (monitoriza-
ción y manipulación de información en línea en la memoria de
trabajo) e Inhibición “Inhibition” (controlar la producción de
respuestas predominantes automáticas). Sin embargo; existen
otros procesos cognitivos dentro de las FE y que se encuentran
relacionadas a la activación en la CPF. A continuación se des-
cribe brevemente en que consisten estas funciones.
La Flexibilidad Cognitiva (FC) se refiere a la capacidad de
cambiar entre tareas
en las que se requiere un mantenimiento
activo de la información e inhibición. Se ha sugerido que tal
ejecución involucra en gran medida el funcionamiento de la
corteza prefrontal dorsolateral (CPFDL), cuando el cambio de
tarea implica el cambio del foco atencional a una dimensión
diferente pues esto implica el procesamiento de información
novedosa y por lo tanto mayor concentración (Diamond et al.,
2002).
La Memoria de Trabajo (MT) es la capacidad de seleccio-
nar el tipo de información relevante y evocarla, ignorando todo
el cúmulo de información que hemos almacenado pero que no
nos sirve en ese momento. Se deben ajustar cambios pertinen-
tes de acuerdo a las demandas de la tarea que estamos realizan-
do dejando por unos instantes el recuerdo que hacía un mo-
mento era importante y evocar otro tipo de información
(Goldberg, 2001).
El proceso de Inhibición se ha definido como la capaci-
dad de oponerse o resistir a realizar una actividad que no es
apropiada o necesaria, no cediendo ante el primer impulso y
dando una respuesta mas adecuada a cambio. (Diamond et al.,
2007). Para que el niño haga una selección apropiada de la
información pertinente y mantenga su atención (enfocada y
sostenida) durante periodos prolongados es esencial que apren-
da a inhibir respuestas que surgen de manera automática (Wod-
ka et al., 2007).
Otra de las funciones mencionadas es la Planeación que se
refiere a la anticipación a eventos o consecuencias futuras; el
uso de objetivos e instrucciones para guiar la conducta; desarro-
llando apropiados pasos para lograr objetivos (Gioia, Espy, &
Isquith, 2003).
La Abstracción es un componente mas de las FE y se re-
fiere a la capacidad para analizar la información (implícita)
presentada (Bungue & Zelazo, 2006).
Se han realizado diversas investigaciones en relación a es-
tas FE y su interacción con factores genéticos, tanto en pobla-
ción infantil como en adulta. Diamond (2004) realizó un estu-
dio de asociación entre el polimorfismo del gen COMT y FE
en 39 niños (M=10 años) conformando un grupo M/M (n=9)
M/V (n=16) y V/V (n=14) evaluados con tareas como Puntos
mixtos y Auto-ordenamiento que requieren de la activación de
la CPF y tareas como Rotación mental de la imagen corporal y
de Recuerdo que requieren de la Corteza Parietal. En este estu-
dio los resultados mostraron que la baja actividad del polimor-
fismo M/M resulta en un mejor rendimiento que con el genoti-
po V/V COMT en una tarea que requiere de memoria de
trabajo e inhibición (Puntos mixtos) pero no así en la prueba de
auto-ordenamiento que requiere de MT. Por lo que concluye
señalando que el polimorfismo del gen COMT tiene un efecto
selectivo en el sistema dopaminérgico de la CPF y las tareas que
requieren de mayor MT e inhibición son mas sensibles a los
niveles de DA en la CPFDL.
Sandoval & Ostrosky.
Rev. Chil. Neuropsicol. 7(3):
115-121, 2012
117
Otro importante estudio es el de Taerk et al. (2004) en el
que se intentó demostrar que el polimorfismo de la enzima
COMT relacionado al catabolismo de la DA, modula los índi-
ces del control ejecutivo y el riesgo de TDAH. Con una mues-
tra de 118 niños con TDAH agrupados de acuerdo al polimor-
fismo M/M n=23 (19.5%), 66 con polimorfismo V/M n= 66
(56%) y un grupo de 29
polimorfismo M/M n= 29 (24.5%)
Obtuvieron que contrario a los resultados de estudios anterio-
res realizados con niños sanos y adultos con esquizofrenia, no
se observan estos efectos del gen COMT en los niños con
TDAH. Ellos sugieren que los resultados obtenidos podrían
explicarse por factores como la corta edad de la muestra (M=9)
y además de que posiblemente las pruebas utilizadas (WCST,
TOL SOPT) requieren de la activación de la CPF pero son
insensibles a los niveles de DA en esta región. Egan et al.
(2001) señalan que el polimorfismo COMT está asociado con
variaciones en la ejecución cognitiva y con la activación fisioló-
gica de la CPF durante tareas de MT, áreas en las que la DA
juega un papel muy importante. Concluyen que el polimorfismo
M/M que cataboliza la DA de forma más lenta, está asociado
con un mejor funcionamiento de la CPF en adultos.
Como se ha mostrado, la CPF parece ser la región neural
más sensible a los niveles de DA al ser particularmente depen-
diente de la acción enzimática de COMT para la inactivación de
la DA extracelular y así mantener el adecuado metabolismo en
esta región; sin embargo, los procesos madurativos del Sistema
Nervioso Central (SNC) no actúan simultáneamente en todas la
regiones cerebrales, al parecer las áreas de proyección maduran
antes que las asociativas, parte de las regiones caudales más
primitivas y termina por las estructuras de mayor complejidad y
evolución lo tiene importantes implicaciones en el desarrollo de
las funciones cognitivas (Flechsig, 1920). Además es importante
tomar en cuenta que la CPF además de ser una de las regiones
de mayor desarrollo evolutivo, se conecta con prácticamente
todo el cerebro, tanto con estructuras corticales como con
estructuras subcorticales (núcleos de la base, núcleo amigdalino,
diencéfalo y cerebelo). Stuss y Benson (1986) señalan que la
CPF, mantiene conexiones recíprocas con el sistema límbico, el
sistema reticular activador y con áreas de asociación posterior.
En base a estos señalamientos y la investigación previa, el
objetivo principal de este estudio es analizar la relación entre el
polimorfismo del gen COMT y la ejecución cognitiva en niños,
específicamente en Funciones Ejecutivas.
Metodología
Diseño
Este estudio es de tipo no experimental, exploratorio y descrip-
tivo con un diseño transversal y comparativo con tre grupos
independientes (homocigotos Met, Homocigotos Val y hetero-
cigotos Val/Met). Se toma a la variable dependiente la puntua-
ción de las subescalas de la Batería Neuropsicológica pata ni-
ños, como variable independiente se encuentra el polimorfismo
del gen COMT (val, met, val/met).
Sujetos
Se evaluaron a 248 niños sanos de 3 a 6 años de edad de una
escuela privada del DF y una escuela pública del Estado de
México.
Procedimiento
Para medir la variable dependiente, se aplicó la Batería de Fun-
ciones Ejecutivas para niños la cual incluye las siguientes tareas:
Stroop Angel/Diablo (inhibición), hora de la comida (MT),
cubos de Corsi en regresión (MT), Stroop Día/Noche (inhibi-
ción), categorización (flexibilidad), dígitos en regresión (MT),
demora de la gratificación (inhibición), el Cartero (planeación),
cajones (flexibilidad), puño/ dedo (inhibición), falsa creencia
(teoría de la mente), falsa creencia de lugar (teoría de la mente),
costo/ beneficio, laberintos (planeación), absurdos (abstrac-
ción), regalo demorado (inhibición). El análisis de cada uno de
los procesos evaluados en los niños no está clasificado de
acuerdo a su relación neuroanatómica ya que en esta población
dichos procesos se encuentran en maduración y por lo tanto no
es posible clasificarlo, además de que trabajan conjuntamente
con otros procesos básicos.
Genotipificación
En cuanto a la variable independiente fue posible gracias al
consentimiento de los padres para tomar una muestra de ADN
a partir de células del epitelio bucal (exudado bucal) de los
niños, utilizando un cepillo de citología (hisopo especializado).
Para el análisis genético se contó con la colaboración de la MSc.
Beatriz Camarena y el Dr. Alejandro Aguilar del Instituto Na-
cional de Psiquiatría (INP), se determinó la frecuencia de los
polimorfismos Val/Val, Val/Met y Met/Met del gen COMT
involucrado en la regulación de DA, este proceso se realizó
mediante el procedimiento estándar que consiste en lo siguien-
te: las células del epitelio bucal fueron lisadas en buffer y trata-
das con proteinasa K (10 mg/ml) a 56 ºC por 24 horas. Se
determinaron los genotipos de la enzima COMT con la técnica
RFLP, después de la amplificación por PCR con primers es-
pecíficos (Comt 1: 5’ CTCATCACCATCGAGATCAA 3´ y
Comt 2: 5´CAGGTCTGACAACGGGTCA 3’). Se empleó 5
ng/mL de ADN, 2,5 mM dNTP, 25 mM Cl2Mg y las siguientes
condiciones: 38 ciclos, 3 min, desnaturalización inicial a 94° C;
12” a 94°C, 25” a 60°C, 30” a 72°C, para la fase de extensión
inicial, seguido de 5 min a 72°C para la extensión final.
Análisis de datos
Se estudió la correlación entre las pruebas de FE con los poli-
morfismos genéticos por medio de un análisis de varianza
(ANOVA one-way) con análisis a posteriori, estableciendo
diferencias significativas con una p<0.05. Para el análisis des-
criptivo y de las relaciones entre las variables, tanto de los datos
neuropsicológicos como los datos genéticos, se empleó la es-
tadística inferencial y mutivariada, utilizando el paquete estadís-
tico SPSS v. 17.
Tabla 1.
Estadística descriptiva de la muestra.
Sexo
Edad
Grupo
Polimorfismo
n
F
M
(M)
Florida
Calli
MET/MET
83
44
39
4.9
67
17
MET/VAL
76
40
36
4.5
47
29
VAL/VAL
89
47
42
4.5
55
33
Total
248
131
117
4.6
169
79
Sandoval & Ostrosky.
Rev. Chil. Neuropsicol. 7(3):
115-121, 2012
118
Figura 1
. Prueba Stroop Ángel/Diablo (errores cometidos) – Control
Inhibitorio.
*p<.05 V/V – M/M p=.011
Figura 3.
Prueba Dígitos en regresión (nivel) – Memoria de
Trabajo.
*p<.05 V/V – V/M (p=.000) V/V – M/M (p=.000)
Figura 2.
Prueba Laberinto (error atravesar) – Control Inhibitorio.
*p<.05 V/V – M/M p=.001
Figura 4
. Prueba Cartero (Puntuación) – Planeación.
*p<.05 V/V – V/M (p=.031) V/V – M/M (p=.044)
Figura 5.
Prueba de Absurdos (Total) – Abstracción.
*p<.05 V/V – M/M (p=.002)
Sandoval & Ostrosky.
Rev. Chil. Neuropsicol. 7(3):
115-121, 2012
119
Resultados
En la tabla 1 se muestran los resultados descriptivos de la
muestra: de los 248 niños de 3 a 6 años de edad (M=4.68) se
formaron los siguientes grupos de acuerdo al polimorfismo
V/V=83 (33.5%), V/M=76 (30.6%) y M/M=89 (35.9%) de los
cuales 131 son niñas y 117 niños.
Efectos genéticos en la cognición
En la prueba estadística utilizada para el análisis de los datos
ANOVA (One-Way) con Post Hoc de Tukey`s se encontró que
existe una diferencia significativa en la comparación entre los
grupos de polimorfismo en la tarea Stroop Ángel/Diablo en el
número de errores cometido (F=4.20; df=2, p<0.05) es una
prueba que requiere de control inhibitorio en la cual el niño
debe ajustar su conducta a los requerimientos de la tarea, en
esta subprueba el niño tenía que hacer lo que le indicara la
figura del ángel e ignorar las instrucciones dadas por la figura
del diablito, los niños con polimorfismo M/M puntuaron mejor
al cometer un menor número de errores que los niños con
polimorfismo V/V (p<.011), mientras que los niños con poli-
morfismo V/M tuvieron un puntaje intermedio (ver figura 1).
De la misma manera, en la tarea Laberintos se encontró
una diferencia significativa en la comparación entre grupos de
polimorfismo en el error del tipo Atravesar (F=6.39; df=2,
p<0.05) cometiendo un menor número de errores el grupo de
niños con polimorfismo M/M. Esta tarea también requiere de
la capacidad de inhibir una conducta inapropiada (ver figura 2).
En cuanto a las tareas relacionadas con la MT, se encon-
traron diferencias significativas en el nivel de la prueba Dígitos
en regresión (F=11.37; df=2, p<0.05), en la cual los niños
deben mantener en la memoria el orden secuencial de los dígi-
tos que deben decir de forma regresiva inmediatamente después
del examinador. Los niños que realizan mejor esta tarea son
aquellos con polimorfismo V/V que los niños con polimorfis-
mo V/M (p<.001) y M/M (p<.000) al alcanzar los primeros un
mayor nivel (ver figura 3).
En la prueba del Cartero en la que el niño debe ordenar
una serie de cartas que pertenecen a casas del mismo color,
tomando en cuenta que no puede ir de reversa sobre la carrete-
ra y que solo puede tomar la carta de arriba del camión, el niño
tiene que planear la forma en que acomodará las cartas en el
camión repartidor de modo tal que ninguna casa se quede sin su
carta. Las diferencias entre grupos (F=4.117, df=2, p<0.05)
fueron entre el grupo de polimorfismo V/V que logró acomo-
dar una mayor cantidad de cartas para repartir que los grupos
V/M (p<.031) y polimorfismo M/M (p<.044) (ver figura 4).
Por último, en la tarea de Absurdos en la que a los niños
se les presenta una serie de imágenes en las que deben detectar
objetos o situaciones que no pertenezcan al contexto de la
imagen. En esta tarea, la diferencia entre los grupos (F=5.839,
df=,2 p<0.05) se encontró entre los niños con polimorfismo
V/V al detectar un mayor número de absurdos en las imágenes
que M/M (p<.002) (ver figura 5).
Discusión
El análisis genético, como el de COMT que afecta sistemas de
neurotransmisión proporciona importante información sobre la
modulación neuroquímica necesaria para el buen funcionamien-
to de procesos cognitivos dependientes de la activación de la
CPF (Diamond, 2004). Los resultados encontrados en
es
te
estudio no son totalmente consistentes con los mostrados en
investigaciones previas realizadas con niños pequeños y sanos,
en los que se muestra que el polimorfismo M/M resulta en un
mejor rendimiento en pruebas de MT e Inhibición que aquellos
con polimorfismo V/V y que dependen de la CPFDL (Dia-
mond, 2004; Barnett et al., 2009).
Estudios como el de Diamond (2009), muestra que el po-
limorfismo M/M resulta en un mejor rendimiento que los
niños con polimorfismo V/V en pruebas de Inhibición como
las tipo Stroop, sin embargo; las diferencias significativas en la
ejecución de estas pruebas
pueden resultar diferentes de acuer-
do al componente emocional, cognitivo o motor que conten-
gan. Nuestros resultados muestran diferencia significativa en
pruebas que requieren de inhibición con componente emocio-
nal y motor. Esto se ha relacionado con la apropiada toma de
decisiones y el adecuado funcionamiento de la Corteza Fron-
tomedial.
Por otro lado, Winstanley et al. (2006) realizó un estudio
utilizando fármacos agonistas de DA en los que se muestran
efectos contradictorios en la inhibición/impulsividad: se obser-
va un aumento de la impulsividad motora y al mismo tiempo
una disminución en la elección de respuestas impulsivas. Lo
que sugiere que diferentes formas de inhibición deben de sus-
tentarse sobre distintos mecanismos neurales, además debe
tenerse en cuenta que el efecto de la DA sobre la conducta
inhibitoria está modulada también por la integridad del sistema
serotoninérgico que a su vez está implicado en procesos como
MT.
COMT tiene un efecto selectivo en la ejecución de tareas
que requieren de inhibición motora ya que al mantenerse por
mas tiempo una mayor cantidad de DA extracelular en la CPF,
los niños M/M parecen mostrar una mayor capacidad para
inhibir las respuestas motoras impulsivas (Stroop A/D y Labe-
rintos – error atravesar) lo que es consistente con los estudios
previos realizados sobre los niveles de DA en la CPF (Dias et
al., 1997; Solanto, 2002; Allen et al., 1998; Winstanley et al.,
2006; Bechara et al., 1997), en los que a su vez se muestra que
un mayor nivel de DA en la CPF se relaciona también con la
inhibición de respuestas hacia pensamientos interferentes, lo
que mejora el proceso de MT (Dígitos en regresión), se elabo-
ran estrategias (Planeación - Cartero) y se tiene un mejor con-
trol emocional y en general cognitivo (Abstracción - Absurdos).
En estos estudios se ha mostrado que son la COF y la CPFVM
las que se encuentran mayormente implicadas en los distintos
aspectos de la inhibición: tanto de respuesta como de elección
(Kirkham, 2003).
En suma, podemos señalar que tanto el hipometabolismo
como el hipermetabolismo de la DA afectan a las funciones
cognitivas, sobre todo a las que son mediadas por la CPF ya
que esta región es mas dependiente de mecanismos secundarios
como la recaptura por medio del DAT o la inactivación en-
zimática para mantener la homeostasis, por lo que el papel que
desempeña la enzima COMT regulada por el gen del mismo
nombre, podría determinar el desempeño de algunas procesos
básicos de las Funciones Ejecutivas en los niños.
Los procesos principales relacionados al metabolismo de
la DA son: Inhibición, Memoria de Trabajo Planeación, Abs-
tracción y actúan de forma simultanea a pesar de las divisiones
neuroanatómicas sugeridas, lo que corresponde al modelo
Multifactorial.
Además, debemos tomar en cuenta que son muchos los
moduladores del desempeño ejecutivo durante la maduración y
el periodo preescolar: características de la crianza, estado de
Sandoval & Ostrosky.
Rev. Chil. Neuropsicol. 7(3):
115-121, 2012
120
salud y nutricional del niños y papás, temperamento del niño y
el nivel socioeconómico.
Limitaciones
El gen COMT tiene influencia en el S. DA, pero no como
factor único, sino en interacción con otros genes y con factores
ambientales. El hecho de la diferencia de los polimorfismos no
necesariamente lleva a que debe haber grandes diferencias en
los niveles de expresión de la proteína, por consecuencia gran-
des diferencias en la cantidad de DA disponible, por lo cual, el
probable efecto del cambio polimórfico en la varianza del feno-
tipo es de esperarse que sea menor y solo se acentuará en mues-
tras muy grandes. Por lo tanto, se sugiere el estudio posterior de
los factores ambientales que participan en la modulación neu-
roquímica del sistema dopaminérgico.
Repercusiones
Es un estudio realizado con una muestra apropiada de niños
pequeños y sanos, además evaluados con un numero importan-
te de pruebas neuropsicológicas. Por otra parte, el estudio del
aspecto genético molecular a nivel individual y poblacional y su
relación de con los procesos comportamentales y cognitivos
son una estrategia para desarrollar el conocimiento y poder
enfrentar a las enfermedades en general y en particular a las
neurológicas.
Agradecimientos
Los resultados encontrados en este estudio se obtuvieron gra-
cias a la colaboración del equipo de trabajo del Laboratorio de
Psicofisiología y Neuropsicología que dirige la Dra. Ostrosky en
la UNAM. Se contó con la colaboración de la MSc. Beatríz
Camarena y el Dr. Alejandro Aguilar del Instituto Nacional de
Psiquiatría (INP) y con la Dra. Sofía Sánchez del Instituto de
Nutrición del
Distrito Federal.
Referencias
Anderson, P., & Anderson, V. (2001). Standardization of the Con-
tingency Naming Test (CNT) for school-age children: a measu-
re of reactive flexibility.
Clinical Neuropsychological Assessment, 4,
119-136.
Baddeley, A. D. (1990).
Human memory: theory and practice
. Oxford:
Oxford University Press.
Bahena–Trujillo, R., Flores, G., & Arias–Montaño, J. (2000). Do-
pamina: síntesis, liberación y receptores en el Sistema Nervioso
Central.
Revista Biomédica, 11
, 39-60.
Barnett, J., Jones, P., Robins, T., & Muller, U. (2007). Effects of
the catechol-O-methyltransferase Val
158
Met polymorphism on
executive function: a meta-analysis of the Wisconsin Card Sort
Test in schizophrenia and healthy controlsMeta-analysis of
COMT and the Wisconsin Card Sort.
Molecular Psychiatry, 12
,
502-509.
Barnett, J., Heron, J., & Goldman, D. (2009). Effects of Catechol-
O-Methyl-transferase on Normal Variation in the Cognitive
Function of Children.
The American Journal of Psychiatry, 166
,
909–916.
Bechara, A., Damasio, H., Tranel, D., & Damasio, A. R. (1997).
Deciding advantageously before knowing the advantageous
strategy.
Science, 275
, 1293–1295.
Blasi, G., Mattay, V., Bertolino, A., Elvevag, B., Callicot, J., Das,
S., Kolachana, B., Egan, M., Goldberg, T., & Weinberger, D.
(2005). Effect of Catechol-
O
-Methyltransferase
val
158
met Geno-
type on Attentional Control. The Journal Neuroscience, 25
(20), 5038-
5045.
Bunge, S., & Zelazo, P. (2006). A Brain-Based Account of the
Development of Rule Use in Childhood.
Psychological Science,
15
(3), 118-121.
Cohen J. D., Braver, T., & O’Reilly, R. (1996). A computational
approach to prefrontal cortex, cognitive control and schizoph-
renia: recent developments and current challenges.
Philosophical
Transactions of the Royal Society B: Biological Sciences
,
14
, 433-443.
Collette, F., Hogge, M., Salmon, E., & Van der Linden,
M. (2006).
Exploration of the neural substrates of executive functioning
by functional neuroimaging.
Neuroscience, 7
, 411-417.
Diamond, A., Briand, L., Fossela, J., & Gehlbach, L. (2004). Gene-
tic and neurochemical modulation of prefrontal cognitive func-
tions in children.
American Journal of Psychiatry,161
, 125-132.
Diamond, A., & Goldman-Rakic P. S. (1989). Comparison of
human infants and rhesus monkeys on Piaget’s AB task: evi-
dence for dependence on dorsolateral prefrontal cortex.
Expe-
rimental Brain Research
,
74
, 24-40.
Diamond, A. (2007). Consequences of variations in genes that
affect dopamine in prefrontal cortex.
Cerebral Cortex, 67
, 161-
170.
Diamond, A. (2002).
A model system for studying the role of dopamine in
prefrontal cortex during early development in humans.
En Johnson y
Munakata, Gilmore (eds.), Brain Development and Cognition.
Blackwell Publishers, 466-503.
Diamond, A., Kirkham, N., & Amso, D. (2002). Conditions under
which young children can hold two rules in mind and inhibit a
prepotent response.
Developmental Psychology, 38,
352- 362.
Diamond, A., Barnett, W., Thomas, J., & Munro, S. (2007).
Science
, 30
, 1388.
Diamond, A., & Doar, B. (1989). The performance of human
infants on a measure of frontal cortex function, the delayed
response task.
Developmental Psychobiology, 74
, 24-40.
Diamond, A. (2006).
The early development of executive functions
. En
Bialystok y Craik (eds.), Lifespan Cognition: Mechanisms of
Change. NY: Oxford University Press.
Dias, R., Robbins, T. W., & Roberts, A. C. (1996). Dissociation in
prefrontal cortex of affective and attentional shifts.
Nature,
380
, 69–72.
Egan, M., Goldberg, T., Kolachana, B., Callicott, J., Mazzanti, C.,
Goldman, D., &
We
inberger
,
D
.
(2001
)
.
Effec
t
of
COMT
Val108/158 Met genotype on frontal lobe function and risk for
schizophrenia.
Proceedings of the National Academic Sciences USA,
98
, 6917– 6922.
Flechsig, P. (1920). Anatomie des Menschlichen Gehirns und
Rückenmarks auf Myelogenetischer Grundlage. Leipzg. En
Klingberg, T., Forssberg, H., Westerberg, H. (2002) Increased
Brain Activity in Frontal and Parietal Cortex Underlies the De-
velopment of Visuospatial Working Memory Capacity during
Childhood.
Journal of Cognitive Neuroscience,
14
, 1- 10.
Gioia, G., Espy, K., & Isquith, P. (2003). Behavior Rating Invento-
ry of Executive Function- Preschool Version (BRIEF-P) Ode-
sa, FL. Psychological Assessment Resources Inc.
Goldberg, E. (2001). El Cerebro Ejecutivo: lobulos frontales y
mente civilizada. Crítica, Barcelona.
Harris, L. (2005).
Psychology.
Wiley Publishing, Inc. Canada.
Kirkham, N., Cruess, L., & Diamond, A. (2003). Helping children
apply their knowledge to their behavior on a dimension-
switching task.
Developmental Science, 6
(5), 449-467.
Krugel, L., Biele, G., Mohr, P., Li, S., & Heekeren, H. (2009).
Genetic enetic variation in dopaminergic neuromodulation in-
fluences the ability to rapidly and flexibly adapt decisions.
Pro-
ceedings of the National Academic of Science PNAS, 106
(42), 17951-
17956.
Lezak, M. (1983). The problem of assessing executive functions.
Neuropsychological assessment (2a. ed.) New York: Oxford
University Press.
Sandoval & Ostrosky.
Rev. Chil. Neuropsicol. 7(3):
115-121, 2012
121
Lie, C., Specht, K., Marshall, J., & Fink, G. (2006). Using fMRI to
decompose the neural processes underlying the Wisconsin
Card Sorting Test.
NeuroImage, 30
(3), 1038-1049.
Lypsky, R., Sparling, M., Ryan, L., Xu, Ke., Salazar, A., Goldman,
D., & Warden, D. (2005). Association of COMT Val158Met
Genotype with Executive Functioning Following Traumatic
Injury.
The Journal of Neuropsychiatry and Clinical Neuroscience,
17,
465-471.
Mannisto, P., & Kaakkola, S. (1999). Catechol-
O
-methyltransferase
(COMT): Biochemistry, Molecular Biology, Pharmacology, and
Clinical Efficacy of the New Selective COMT Inhibitors.
Phar-
macological Reviews, 51
(4), 593-628.
Meyer-Lindenberg, A. et al. (2005). Midbrain dopamine and pre-
frontal function in humans: interaction and modulation by
COMT genotype.
Nature Neuroscience, 8
(5), 594–596.
Miyake, A., Friedman, N., Emerson, M., Witzki, A., & Howerter,
A. (2000). The unity and diversity of executive functions and
their contributions to complex “frontal lobe” tasks: A latent
variable analysis. Cognitive Psychology, 41, 49-100.
Nokelainen, P., & Flint, J. (2002). Genetic effects on human
cognition : lessons from the study of mental retardation syn-
dromes.
Journal of Neurology, Neurosurgery & Psychiatry
,
72
, 287-
296.
Rodriguez-Aranda, C., & Sundet, K. (2006). The frontal
hypot-
hesis of cognitive aging: Factor structure and age effects on
four frontal tests among healthy individuals.
Journal of Genetic
Psychology, 167
, 269-287.
Salthouse, T. (2005). Relations between cognitive abilities and
measures of executive functioning.
Neuropsychology, 19
, 532-545.
Solanto, M. (2002). Dopamine dysfunction in AD/HD: Integrating
clinical and basic neuroscience research.
Behavioural Brain Rese-
arch, 130
, 65-71.
Stuss,
D. T., & Benson, D. (1984). Neuropsychological studies of
the frontal lobes.
Psychological
Bulletin, 95
, 3-28.
Stuss, D. (1992). Biological and psychological development of
executive functions.
Brain and Cognition, 20,
8-23.
Stuss, D., & Alexander, M. (2000). Executive functions and the
frontal lobes: A conceptual view.
Psychological Research, 63
, 3-4.
Stuss, D., & Levine, B. (2002). Adult Clinical Neuropsychology:
lessons from studies of the frontal lobes.
Annual Review of Psy-
chology, 53
, 401- 433.
Taerk, E., Grizenko, N., Ben Amor, L., Lageix, P., Mbekou, V.,
Deguzman, R., Torkaman-Zehi, A., Stepanian, M., Baron, C.,
&
Joober,
R.
(2004).
Catechol-O-Methyltransferase
(COMT)
Val
108/158
Met
polymorphism does not modulate executive func-
tion in children with ADHD.
BMC Medical Genetics, 10,
1186-
1471.
Wagner, K., Jonas, J., Findling, R., Ventura, D., & Saikali, K.
(2006). A Double-Blind, Randomized, Placebo-Controlled
Trial of Escitalopram in the Treatment of Pediatric Depresion.
Journal of the American Academy of Child & Adolescent Psychiatry,
45
(3), 280-288.
Wodka, E., Mahone, E., Blankner, J., Gidley, L. Fotedar, S., Denc-
kla, M., & Mostofsky, S. (2007). Evidence that response inhibi-
tion is a primary deficit in ADHD.
Journal of Clinical and Expe-
rimental Neuropsychology, 29
(4
), 345-356.
Winstanley, C., Theobald, D., Dalley, J., Cardinal, R., & Robbins,
T. (2006). Double Dissociation between Serotonergic and Do-
paminergic Modulation of Medial Prefrontal and Orbittofron-
tal Cortex during a Test of Impulsive Choice.
Oxford Journals,
16,
(1), 106-114.
logo_pie_uaemex.mx