Leptospira spp. were cultured in Ellinghausen-McCullough-Johnson-Harris (EMJH) liquid medium (Difco, BD, São Paulo, Brazil) supplemented with Leptospira enrichment EMJH (Difco, BD, São Paulo, Brazil) at 30°C (Silva et al., 2007). The serovars used in this study included the L. borgpetersenii serovar Javanica and Sejroe, L. interrogans serovar Pomona, Canicola, and Copenhageni, L. kirschneri serovar Grippotyphosa and Cynopteri, and L. biflexa serovar Ranarum. Escherichia coli BL21 (DE3) Star (Thermo-Fisher, Illinois, USA) were grown at 37°C in Luria-Bertani (LB) medium (1% tryptone, 0.5% yeast extract, 0.5% NaCl, and 2% agar) with the addition of ampicillin (Sigma-Aldrich, Missouri, USA) to 100 µg mL^-1.

The presence of the erpY-like gene among Leptospira spp. serovars was performed using polymerase chain reaction (PCR) assay. The technique was applied to amplify the erpY-like gene by using a genomic deoxyribonucleic acid (DNA) from eight serovars, including L. borgpetersenii serovars Javanica and Sejroe, L. interrogans serovars Canicola, Pomona, and Copenhageni, L. kirschneri serovars Grippotyphosa and Cynopteri, and L. biflexa serovar Ranarum. PCR was performed using the following oligonucleotides: erpY-like F: 5′‑ACTCTCGAGGAAATCATGAACGCT–3′ and erpY-like R: 5′‑ACGGAATTCTTGAGAAGCGTATTC–3′. The primers were designed using VectorNTI 11 software (Thermo-Fisher, Illinois, USA) according to the L. interrogans serovar Copenhageni genome (GenBank: AE016823). PCR reactions happened as followed: 94°C for 5 min., followed by 35 cycles of 94°C for 1 min., 50°C for 1 min., and 72°C for 1 min., with a final extension of 72°C for 7 min. Reactions were performed in a final volume of 25 μL using Taq DNA Polymerase (GoTaq Colorless Master Mix) (ProMega, São Paulo, Brazil) in a Mastercycler thermal cycler (Eppendorf, Hamburg, Germany). The amplification products were visualized by 1% agarose gel electrophoresis.

The gene encoding the ErpY-like protein (approximately 390 bp) was synthesized (GenOne, Rio de Janeiro, Brazil) based on the genomic sequence of L. interrogans serovar Copenhageni strain L1–130 (FIOCRUZ, Bahia, Brazil) available at GenBank (GenBank: AE016823). The erpY-like gene was obtained, cloned in the pAE vector (Ramos, Abreu, Nascimento, & Ho, 2004), and fused with an N-terminal 6×His-tag. The pAE/erpY-like plasmid was used to transform E. coli BL21 (DE3) Star cells (Thermo-Fisher, Illinois, USA), which were cultivated in LB medium (tryptone 1.6%, yeast extract 1%, and NaCl 0.5%, pH 7.0) containing ampicillin (100 µg mL^-1) (Sigma-Aldrich, Missouri, USA) (Sambrook & Russell, 2001). When the absorbance at 600 nm (OD₆₀₀) reached 0.8, 1 mmol L^-1 isopropyl‑β‑D‑thiogalactopyranoside (Sigma-Aldrich, Missouri, USA) was added, and the cells were harvested by centrifugation (4,000 × g for 15 min. at 4°C) 3 hours later. After centrifugation, the cells were lysed by sonication and centrifuged (11,000 × g for 30 min. at 4°C). For protein purification, cell pellets were suspended in a solubilization buffer (8 M urea, 200 mM NaH₂PO₄, 0.5 M NaCl, and 5 mM imidazole, pH 8.0). Purification was performed by immobilized metal ion affinity chromatography using Ni²⁺ Sepharose HisTrap columns, with the adoption of the ÄKTA prime liquid chromatography system (GE Healthcare, Illinois, USA). The purified proteins were dialyzed against phosphate-buffered saline (PBS) with pH 8.0 and decreasing concentrations of urea (Sigma-Aldrich, Missouri, USA) in 16 steps over five days at 4°C. The purification was evaluated by 15% SDS‑PAGE (sodium dodecyl sulphate-polyacrylamide gel electrophoresis) and the gels were stained with 0,1% comassie blue G-250, 25% methanol, 5% acetic acid (Sigma-Aldrich, Missouri, USA) at room temperature for 16-18 hours. After, the coomassie blue was removed using 7% acetic acid (Sigma-Aldrich, Missouri, USA). The expression of the rErpY-like protein was confirmed by Western Blotting (WB), by employing an anti–6× His-tag monoclonal antibody (Sigma-Aldrich, Missouri, USA). Briefly, the rErpY-like protein was separated by 15% SDS-PAGE and electro-transferred onto nitrocellulose membranes (GE Healthcare, Illinois, USA). The membranes were blocked with PBS‑FBS 1%, (phosphate buffered saline with 1% [v/v] fetal bovine serum) and reacted with the anti–6 × His-tag monoclonal antibody (Sigma-Aldrich, Missouri, USA) at 1:100 dilution in PBS. Then, a goat anti-mouse Ig peroxidase conjugate (Sigma-Aldrich, Missouri, USA) was added at 1:4,000 dilution. Incubations were performed for 1 hour at room temperature in agitation (50 rpm) and washed with PBS-T (PBS with 0.05% [v v^-1] Tween 20) between all steps. Then, reactions were developed with a chromogen/substrate solution (6 mg diaminobenzidine, 0.03% nickel sulfate, 50 mM Tris-HCl, pH 8.0, and 0.03% hydrogen peroxide) for the visualization of protein bands. The rErpY-like protein was quantified using a BCA Protein Assay Kit (Thermo-Fisher, Illinois, USA) and stored at -20°C.

Antigenicity was evaluated by the capacity of the rErpY-like protein to be recognized by antibodies present in sera. Thus, an indirect ELISA was performed using sera from humans, swine, and canines naturally infected and positive to leptospirosis (reciprocal MAT titer >1:25,000) in pools of 5 samples, anti-Leptospira hyperimmune sera of rabbit, and normal mouse serum (as a negative control) provided by the Immunodiagnostic Laboratory of the Universidade Federal de Pelotas, Pelotas, Rio Grande do Sul, Brazil. Briefly, polystyrene plates (Polysorp, Nunc, São Paulo, Brazil) were coated with rErpY-like protein diluted in a carbonate-bicarbonate buffer, pH 9.6, at a concentration of 200 ng per well, and blocked with PBS-FBS 1%. Sera samples were diluted 1:50 in PBS-T. Then, anti-Ig peroxidase conjugates specific for human, swine, canine, and rabbit (Sigma-Aldrich, Missouri, USA), diluted as 1:10,000, 1:5,000, 1:6,000 and 1:4,000, respectively, were added. The presence of antigen-antibody complex was revealed by adding a substrate solution containing o-phenylenediamine (0.4 mg mL^-1 in 0.1 M citrate buffer, pH 5.0) and 0.03% hydrogen peroxide (Sigma-Aldrich, Missouri, USA). The reaction was stopped by adding 0.1 M of sulfuric acid (Sigma-Aldrich, Missouri, USA) and the absorbance was determined at 492 nm (OD₄₉₂), by using the VICTORTM X5 Multilabel Plate Reader (Perkin Elmer, Massachusetts, USA). All assay steps were performed in 100 μL well^-1, at 37°C for 1 hour, and the plates were washed three times with PBS-T between the steps.

For anti-ErpY-like protein polyclonal antibody (pAb) production, two 6-week-old BALB/c mice were injected intraperitoneally with 100 μg of rErpY-like protein on days 0, 14, 21, and 28. Freund’s complete adjuvant (Sigma-Aldrich, Missouri, USA) was used in the first dose and Freund’s incomplete adjuvant (Sigma-Aldrich, Missouri, USA) in the subsequent ones. On day 35, blood samples were collected from the retro-orbital venous plexus after the administration of eye anesthetic drops to determine antibody levels. Then, the mice were boosted with another dose of 100 μg of rErpY-like protein. The blood was collected, centrifuged, and purified by affinity chromatography using a protein A-Sepharose CL-4B column (GE Healthcare, Illinois, USA) according to the manufacturer’s instructions. Next, an indirect ELISA was performed to determine the rErpY-like protein antibody titer. For titration, polystyrene ELISA microtiter plates (Polysorp, Nunc, São Paulo, Brazil) were coated with rErpY-like protein (200 ng well^-1) and blocked with PBS-FBS 1%. Serial dilutions (1:100–1:512,000) of pAb were added to the wells. Then, goat anti-mouse Ig peroxidase conjugate (Sigma-Aldrich, Missouri, USA), diluted 1:5000, was added for sera antibody detection. The presence of an antigen-antibody complex was revealed, and the reaction was stopped by adding 0.1 M of sulfuric acid (Sigma-Aldrich, Missouri, USA). The absorbance was determined at 492 nm, by using VICTOR^TM X5 Multilabel Plate Reader (Perkin Elmer, Massachusetts, USA). All assay steps were performed in 100 μL well^-1, at 37°C for 1 hour, and the plates were washed three times with PBS-T.

All animal experiments described in this study were performed in strict accordance with the guidelines of the National Council for Control of Animal Experimentation, Brazil (CONCEA, nº 11794) and approved by the Ethics Committee in Animal Experimentation, Universidade Federal de Pelotas, Brazil (Permit number: 5429).

An indirect ELISA was performed to determine the levels of anti-rErpY-like IgG subclasses in the mice serum, according to the experiment previously described (Schuch et al., 2017). Polystyrene 96-well plates (Polysorp, Nunc, São Paulo, Brazil) were coated with rErpY-like protein diluted in carbonate-bicarbonate buffer, with pH 9.6, at a concentration of 100 ng well^-1 for 16 hours at 4°C. The plates were blocked with 200 μL of PBS-FBS 5% at 37°C for 2 hours. Then, the mice serum samples were added to wells at 1:100 in triplicates followed by incubation for 1 hour at 37°C. Goat anti-mouse primary antibodies anti-isotype IgG1, IgG2a, IgG2b, or IgG3 (Sigma-Aldrich, Missouri, USA) were added at 1:1000 for 1 hours at 37°C. For reaction development, a rabbit anti-goat IgG peroxidase conjugate (Sigma-Aldrich, Missouri, USA) was added at 1:5,000 for 1 hour at 37°C, followed by the liquid substrate 3,3,5,5-tetramethylbenzidine (Sigma-Aldrich, Missouri, USA) for 15 min. at 37°C. Between all steps, PBS-T washes were performed to remove non-bound components. The reaction was stopped by adding 0.1 M of sulfuric acid (Sigma-Aldrich, Missouri, USA) and the absorbance was determined at 492 nm by using a VICTOR^TM X5 Multilabel Plate Reader (Perkin Elmer, Massachusetts, USA).

Data are expressed as mean ±SEM (standard error of the mean) and significant differences between groups were determined using the analysis of variance and Tukey’s post-test. The p < 0.05 value was considered statistically significant. Analyses were performed using Prism 6 software (GraphPad Software Inc., La Jolla, USA).

PCR analysis showed that the erpY-like gene is present in all pathogenic serovars tested (L. interrogans serovars Pomona, Canicola, and Copenhageni, L. borgpetersenii serovars Javanica and Sejroe, and L. kirschneri serovars Grippotyphosa and Cynopteri) and absent in saprophytic L. biflexa serovar Ranarum (Figure 1).

Figure 1. Distribution of erpY-like gene among serovars of Leptospira spp. The genomic DNA of different serovars of L. biflexa, L. interrogans, L. borgpetersenii, and L. kirschneri were submitted to PCR with specific oligonucleotides and visualized at 1% agarose gel.

The rErpY-like protein was expressed in E. coli in an insoluble form, with the expected size of 13 kDa. After dialysis against PBS, the protocol for solubilization in urea and purification of recombinant protein resulted in a yield of 25 mg L^-1. The rErpY-like protein expression was confirmed by WB assay using an anti–6×His-tag monoclonal antibody. Antigenicity of rErpY-like protein was confirmed in an indirect ELISA. Antigenicity of the purified protein was evaluated with sera from naturally infected human, swine, and canine, which were MAT positive to leptospirosis, in addition of rabbit anti‑Leptospira hyperimmune sera. The rErpY-like protein produced in E. coli was recognized by all sera samples evaluated, as shown in Figure 2. Normal mouse serum used as a negative control did not demonstrate a detectable reaction.

Figure 2. Antigenicity of rErpY-like protein. The rErpY-like protein was used as antigen in ELISA with pooled sera from human, swine, and canine positives to leptospirosis. A rabbit anti-Leptospira hyperimmune serum was used as positive control. No detectable reaction was observed in normal mouse serum (negative control). The results represent mean absorbance ± mean standard error calculated from the serum samples assayed in duplicate. OD₄₉₂ = optical density at 492 nm. The significance was determined by the analysis of variance (Tukey’s multiple comparison) and the different letters indicate a significant difference (p < 0.05) between samples.

The pAb against rErpY-like protein was successfully produced, purified and titrated, therefore showing a reaction with the rErpY-like protein until the dilution of 1:12,800. In the WB assay, the pAb recognized the recombinant protein in the expected size of 13 kDa. As shown in Figure 3, pAb isotyping revealed the presence of IgG1, IgG2a, IgG2b, and IgG3 subclasses. However, IgG1 and IgG2a showed a significantly higher response (p < 0.05) compared with other subclasses. At OD₄₉₂nm, IgG1 and IgG2a isotypes obtained mean absorbances close to 3.0, while IgG2b obtained at approximately 2.5 and IgG3 at approximately 1.2. Thus, the isotype profile of pAb against rErpY-like protein observed was IgG1=IgG2a>IgG2b>IgG3, as demonstrated by the mean absorbances obtained in the indirect ELISA, for each subclass of IgG.

Figure 3. Isotyping of anti-rErpY-like IgG subclasses. BALB/c mice were intraperitoneally immunized with rErpY-like (100 µg) in combination with Freund’s complete adjuvant (Sigma Aldrich, USA) in the first dose and Freund’s incomplete adjuvant (Sigma Aldrich, USA) in the subsequent ones (days 14, 21, and 28). Blood was collected on day 35 post-immunization. The responses of the IgG isotypes (IgG1, IgG2a, IgG2b, and IgG3) were determined by ELISA with 100 ng mL^-1 of antigenrErpY-like and 1:100 of mouse serum dilution. The results represent the mean absorbance ± SEM, calculated from pAb samples assayed in duplicate. The significance was determined by the analysis of variance (Tukey's multiple comparison) and the different letters indicate a significant difference (p < 0.05) between samples

daianehartwig@gmail.com