Ticks (Acari: Ixodidae) are hematophagous arthropods, parasites of vertebrates with more than 920 valid species worldwide, 52 of them reported from Argentina (Guglielmone et al., 2014, 2015; Nava et al., 2017; Saracho-Bottero et al., 2021). Ticks have relevance as parasites themselves and as vectors of zoonotic diseases (Jongejan & Uilenberg, 2004). These arthropods can acquire pathogenic agents by feeding blood of infected animals or by transstadial and transovarial transmission. The pathogenic agents include Rickettsia, a group of gram-negative bacteria with worldwide distribution which includes zoonotic species usually transmitted by arthropod vectors (Parola et al., 2013). In Argentina, clinical cases of rickettsial diseases have been reported in different provinces, including Buenos Aires (Romer et al., 2020).

Sigmodontine rodents (Cricetidae) are common hosts of immature stages of ticks (Beldoménico et al., 2005). These mammals are widely distributed in Argentina inhabiting almost all habitat types, and some species are reservoirs zoonotic agents, such as rickettsias (Meerburg et al., 2009; Patton et al., 2015). Moreover, some of the ectoparasites associated with sigmodontines, such as ticks, are involved in the enzootic cycle of these bacteria. Because of the proximity of the habitats of sigmodontine with humans, these rodents are important from an epidemiological perspective (Meerburg et al., 2009; Guglielmone et al., 2014).

Herein, we analyze the presence of Rickettsia in ticks parasitic of sigmodontine rodents in two areas of northeastern Buenos Aires province, Argentina, where cases of rickettsiosis were reported but the vector remains unknown.

Samplings were carried out between 2017 and 2018 throughout nine collection campaigns in two localities with different degrees of anthropization situated in La Pampa biogeographic province (Morrone, 2006). One of these (Arana) is mostly rural, located in the suburbs of La Plata (35º00’S, 57º54’W), with a surface of five hectares mostly composed of pasturelands (five sampling campaigns). The other location (La Balandra) is situated on the margin of Río de la Plata, in the city of Berisso (34º56'S, 57º42'W) and it is characterized by forested wetlands intercalated with coastal strips emerging from water (four sampling campaigns). The sampling effort was 80 traps per night placed in a distance of five meters one from each other for 24 hours. Rodents were captured alive by using Sherman-like traps baited with oat.

A total of 222 rodents were captured, and ticks were collected from their furs in the field and preserved in ethanol 96%. At the laboratory ticks were identified under stereoscopic binocular microscope by using the taxonomic keys and morphological descriptions presented in Nava et al. (2017). Afterwards, for molecular studies, ticks were processed individually. Tick genomic DNA was extracted with phenol-chloroform method, as described in Mangold et al. (1998). Tick DNA samples were tested for the presence of rickettsial citrate synthase (gltA) gene (primers CS5: GAGAGAAAATTATATCCAAATGTTGAT and CS6: AGGGTCTTCGTGCATTTCTT) by real-time PCR as described by Labruna et al. (2004) and Guedes et al. (2005). Positive samples were further analysed by a battery of conventional PCR methods targeting a 834 bp fragment of gltA gene (primers CS-239: CTCTTCTCATCCTATGGCTATTAT and CS-1069: CAGGGTCTTCGTGCATTTCTT) (Labruna et al., 2004), a 512 bp fragment of outer membrane protein A (ompA) gene (primers Rr190.70p: ATGGCGAATATTTCTCCAAAA and Rr190.602n: AGTGCAGCATTCGCTCCCCCT) (Regnery et al., 1991) and a 862 bp fragment of outer membrane protein B (ompB) (primers 120-M59: CCGCAGGGTTGGTAACTGC and 120-807: CCTTTTAGATTACCGCCTAA) (Roux & Raoult, 2000). In all PCR methods, DNA of R. parkeri sensu stricto from Brazil was used as positive control. Positive PCR fragments were purified using a commercial kit (Wizard® SV Gel and PCR Clean-Up System, Promega) and sequenced in ABI 3130XL Genetic Analyser (INTA Castelar, Buenos Aires, Argentina). Obtained partial sequences were edited using BioEdit software (Hall, 1999) with manual edition whenever it was necessary, aligned with the program Clustal W (Thompson et al., 1994) and compared with sequences deposited in GenBank™ by using BLAST tools (https://blast.ncbi.nlm.nih.gov/Blast.cgi) Phylogenetic analyses were performed with Maximum-likelihood (ML) method by using the program Mega 5 (Tamura et al., 2011). Best fitting substitution models were determined with the Akaike Information Criterion using the ML model test implemented in MEGA 5 (Substitution models were T92 (G+I). Support for the topologies was tested by bootstrapping over 1,000 replications and excluding gaps.

Rodents were identified by Ulyses Pardiñas (IDEAus, CONICET) and Carlos Galliari (CEPAVE) and will be deposited at the Colección de Mamíferos del Centro Nacional Patagónico, Puerto Madryn, Chubut, Argentina.

The 222 rodents were determined as Oxymycterus rufus Fischer (n = 70), Akodon azarae Fischer (n = 66), Oligoryzomys flavescens (Waterhouse) (n = 35), Scapteromys aquaticus Thomas (n = 33); Oligoryzomys nigripes Olfers (n = 15) and Deltamys kempi Thomas (n = 3) (Cricetidae, Sigmodontinae). A total of ten ticks (nine nymphs and one larva) were collected and determined as Ixodes loricatus Neumann. Ticks collected on each host species and localities are shown in table I.

Out of these ten specimens of I. loricatus screened in real-time PCR, three nymphs showed amplification for the gltA gene. These samples were also positive in the conventional PCR showing amplicons of the expected sizes for the gltA gene. No amplification was observed in the ompA and ompB PCR tests of these three ticks.

The three positive gltA samples were obtained from three I. loricatus nymphs collected each one on D. kempi, O. rufus and A. azarae, respectively. Sequences of gltA were deposited in the GenBank™ (Accession numbers: MT407574; MT407575 & MT407576 respectively). These sequences matched with more than 99% of similarity with gltA sequences available in GenBank™ of R. bellii. The phylogenetic tree constructed with the sequences obtained in this work (Fig. 1) clearly shows that they are grouped with R. bellii (Accession numbers KX137900, CP000087, LAOI100001, CP015010) and separated from other rickettsial groups.

The present study evaluates the rickettsial infection in I. loricatus ticks collected on sigmodontine rodents in the northeastern region of Buenos Aires province. Ixodes loricatus is distributed in areas of Argentina, Brazil, Paraguay and Uruguay belonging to the Pampa, Chaco and Parana forest biogeographic provinces sensuMorrone (2006), with adults usually found in marsupials (Didelphidae) and their immature stages in sigmodontine rodents (Cricetidae) and also in marsupials (Didelphidae) (Nava et al., 2017). In this work, I. loricatus was the only tick species collected, which is in accordance with the literature that indicates that this specie is the most prevalent in sigmodontine rodents from Buenos Aires (Beldoménico et al., 2005). Even though a small number of ticks was collected and tested (n = 10), 30% of them were positive for R. bellii suggesting a high prevalence of this bacterium in I. loricatus from the study area.

According to previous reports, R. bellii was only isolated in ticks and it is widely distributed in America as resumed by Krawczak et al. (2018). In Argentina, R. bellii was detected in free living ticks of Amblyomma sculptum Berlese, A. ovale Koch, A. neumanni Ribaga, A. tigrinum Koch, Haemaphysalis juxtakochi Cooley and A. dubitatum Neumann collected on Hydrochoerus hydrochaeris L. (Caviidae) (Nava et al., 2017; Sebastian et al., 2017).

This is the first report of R. bellii infecting I. loricatus in Argentina and the first isolation of this bacterium in ticks associated with sigmodontine rodents. Nevertheless, additional research is required to determine the role of these mammals and their ectoparasites in the enzootic cycle of R. bellii. Until the epidemiological relevance of this species is fully clarified, the importance of its isolation should not be underestimated.

ACKNOWLEDGMENTS

Authors thank Luis Giambelucca, Ekaterina Savchenko and Carlos Galliari (CEPAVE) for their contribution to the fieldwork; to C. Galliari and Ulyses Pardiñas (IDEAus, CONICET, Argentina) for the identification of the rodents. We also thank the Ministerio de Agroindustria (Buenos Aires province) for the permission to collect rodents (Authorization 66/17). This work was supported by the Agencia Nacional de Promoción Científica y Tecnológica (PICT 2015-1564), Universidad Nacional de La Plata, Argentina (N854) (both granted to M. Lareschi) and CONICET (PUE 22920160100036CO).

REFERENCES

Beldoménico, P.M., Lareschi, M., Nava, S., Mangold, A.J., & Guglielmone, A.A. (2005) The parasitism of immature stages of Ixodes loricatus (Acari: Ixodidae) on wild rodents in Argentina. Experimental and Applied Acarology, 36(1-2), 139-148.

Guedes, E., Leite, R.C., Prata, M.C., Pacheco, R.C., Walker, D.H., & Labruna, M.B. (2005) Detection of Rickettsia rickettsii in the tick Amblyomma cajennense in a new Brazilian spotted fever-endemic area in the state of Minas Gerais. Memórias do Instituto Oswaldo Cruz, 100(8), 841-845.

Guglielmone, A.A., Robbins, R.G., Apanaskevich, D.A., Petney, T.N., Estrada-Peña, A., & Horak, I.G. (2014) The Hard Ticks of the World (Acari: Ixodida: Ixodidae). Springer, The Netherlands.

Guglielmone, A.A., Sánchez, M.E., Franco, L.G., Nava, S., Rueda, L.M., & Robbins, R.G. (2015) Nombres de Especies de Garrapatas Duras (Acari: Ixodidae: Ixodidae). http://rafaela.inta.gob.ar/nombresgarrapatas/. Last accession May 25, 2020.

Hall, T.A. (1999) BioEdit: A User-Friendly Biological Sequence Alignment Editor and Analysis Program for Windows 95/98/NT. Nucleic Acids Symposium Series, 41, 95-98.

Jongejan, F., & Uilenberg, G. (2004) The global importance of ticks. Parasitology, 129(1), S3-S14.

Krawczak, F.S., Labruna, M.B., Hecht, J.A., Paddock, C.D., & Karpathy, S.E. (2018) Genotypic Characterization of Rickettsia bellii Reveals Distinct Lineages in the United States and South America. BioMed Research International, 2018, 8505483.

Labruna, M.B., Whitworth, T., Horta, M.C., Bouyer, D.H., McBride, J.W., Pintér, A., Popov, V., Gennari, S.M., & Walker, D.H. (2004) Rickettsia Species Infecting Amblyomma cooperi Ticks from an Area in the State of Sao Paulo, Brazil, Where Brazilian Spotted Fever Is Endemic. Journal of Clinical Microbiology, 42(1), 90-98.

Mangold, A.J., Bargues, M.D., & Mas-Coma, S. (1998) Mitochondrial 16S rDNA sequences and phylogenetic relationships of species of Rhipicephalus and other tick genera among Metastriata (Acari: Ixodidae). Parasitology Research, 84(6), 478-484.

Meerburg, B.G., Singleton, G.R., & Kijlstra, A. (2009) Rodent-borne diseases and their risks for public health. Critical Reviews in Microbiology, 35(3), 221-270.

Morrone, J.J. (2006) Biogeographic Areas And Transition Zones Of Latin America And The Caribbean Islands Based On Panbiogeographic And Cladistic Analyses Of The Entomofauna. Annual Review of Entomology, 51(1), 467-494.

Nava, S., Venzal, J.M., González-Acuña, D., Martins, T.F., & Guglielmone, A.A. (2017) Ticks of the southern cone of America. Elsevier, Academic Press, London, United Kingdom.

Parola, P., Paddock, C.D., Socolovschi, C., Labruna, M.B., Mediannikov, O., Kernif, T., Abdad, M.Y., Stenos, J., Bitam, I., et al. (2013) Update on Tick-Borne Rickettsioses around the World: a Geographic Approach. Clinical Microbiology Reviews, 26(4), 657-702.

Patton, J.L., Pardiñas, U.F.J., & D’Elia, G. (2015) Mammals of South America. Rodents. Vol. 2. University of Chicago Press, Chicago, Illinois, United States.

Regnery, R.L., Spruill, C.L., & Plikaytis, B.D. (1991) Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. Journal of Bacteriology, 173(5), 1576-1589.

Romer, Y., Borrás, P., Govedic, F., Nava, S., Carranza, J.I., Santini, S., Armitano, R., & Lloveras, S. (2020) Clinical and epidemiological comparison of Rickettsia parkeri rickettsiosis, related to Amblyomma triste and Amblyomma tigrinum, in Argentina. Ticks and Tick-borne Diseases, 11(4), 101436.

Roux, V., & Raoult, D. (2000) Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer-membrane protein rOmpB (ompB). International Journal of Systematic and Evolutionary Microbiology, 50(4), 1449-1455.

Saracho-Bottero, M.N., Beati, L., Venzal, J.M., Guardia, L., Thompson, C.S., Mangold, A.J., Guglielmone, A.A., & Nava, S. (2021). Ixodes silvanus n. sp. (Acari: Ixodidae), a new member of the subgenus Trichotoixodes Reznik, 1961 from northwestern Argentina. Ticks and Tick-borne Diseases, 12, 101572.

Sebastian, P.S., Tarragona, E.L., Bottero, M.N., Mangold, A.J., Mackenstedt, U., & Nava, S. (2017) Bacteria of the genera Ehrlichia and Rickettsia in ticks of the family Ixodidae with medical importance in Argentina. Experimental and Applied Acarology, 71(1), 87-96.

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., & Kumar, S. (2011) MEGA5: Molecular Evolutionary Genetics Analysis Using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution, 28(10), 2731-2739.

Thompson, J.D., Higgins, D.G., & Gibson, T.J. (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research, 22(22), 4673-4680.

Author notes

mmelis@cepave.edu.ar