This species is morphologically similar to two other species found in its home range in Europe, Thrips tabaci and a rarely collected host-specialist of the woodland plant Euphorbia amygdaloides, Thrips euphorbiicola Bagnall. These three species all have closely spaced rows of microtrichia on the abdominal pleurotergites (Fig. 2e); the posteromarginal comb on tergite VIII complete with long, fine, microtrichia; the anterior pairs of pores on tergite IX not developed; and second-instar larvae with the lateral spiracles on tergite II absent (this is unusual within the genus Thrips). However, T. origani is morphologically distinct from these other two species, with 1-5 discal setae present on each of sternites III-VI (Fig. 2a), strong dark antecostal ridges on the sternites (Fig. 2a) and tergites, and variable brown and yellow mottling on the tergites. Males are unknown, the species reproducing by thelytokous parthenogenesis.

NEW RECORDS: Argentina, Mendoza, La Consulta (-33.7625, -69.1153): 9 females on Origanum vulgare, 21.x.2014, and 7 females on Origanum vulgare, 13.iii.2023 (coll. S. Panonto). The specimens are deposited in the Thysanoptera collection of the Estación Experimental Agropecuaria, Mendoza, INTA.

1. Abdominal pleurotergites with closely spaced rows of microtrichias (Fig. 2e); abdominal sternite VII without discal setae (Fig. 2a-b) 2

-. Abdominal pleurotergites without closely spaced rows of microtrichia (Fig. 2d); abdominal sternite VII with many discal setae (Fig. 2c) 3

2. Abdominal sternites with a few discal setae (Fig. 2a); antennal segments III-V uniformly brown, III slightly paler than IV-V (Fig. 2i); on Origanum vulgare T. origani

-. Abdominal sternites without discal setae (Fig. 2b); antennal segments III-V, usually slightly bicoloured, darker at apex than base; polyphagous T. tabaci

3. Forewing first vein with continuous row of setae (Fig. 2g); female and male yellow to brown, typically yellow with brown post-occipital ridge on head and brown spots on tergites (Fig. 1a); metanotum with campaniform sensilla (Fig. 1e); on Eucalyptus spp....................... T. australis

-. Forewing first vein with discontinuous row of setae (Fig. 2h); female and male dark brown (Fig. 1b); metanotum without campaniform sensilla 4

4. Antenna 8-segmented; antenna brown, except segment III yellow (Fig. 2k); reticulate metanotum, many of the reticles with internal markings (Fig. 1f) ; on Gladiolus spp T. simplex

-. Antenna 7-segmented, antennal segments III to base of VI paler than the rest of the antennal segments (Fig. 2j); metanotum, with reticles lacking internal markings; on Asteraceae T. trehernei

Fig. 1.

a-c female adults’ full body (a) T. australis (b) T. trehernei (c) T. origani; (d) head with ocellar setae pair I absent, ocellar setae III subequal to or longer than ocellar setae II and pronotum with median pair of setae on posterior margin longer than submedian pair of T. origani; e-f metanotum (e) T. australis, campaniform sensilla present (f) T. simplex, reticles with internal markings.

Four specimens were individually examined under a stereoscopic microscope with 160x magnification and placed in identifiable vials (labeled with a “sample number”). Specimens originally collected from La Consulta, Mendoza, were reared on oregano plants and collected for morphological and molecular characterization (INTA CdB 147 and INTA CdB 148). Additionally, DNA was also extracted from one specimen collected on Senecio subulatus D. Don ex Hook. & Arn. from El Carrizal, Mendoza, and previously identified under a stereoscopic microscope as T. tabaci (INTA CdB 35) and one specimen collected from an unidentified Asteraceae from Mar del Plata, Buenos Aires, and classified as T. trehernei (INTA CdB 131).

Fig. 2.

a-c sternites VI-VIII (a) T. origani, sternites VI with few discal setae and VI without discal setae (b) T. tabaci, sternites VI-VII without discal setae (c) T. trehernei, sternites VI -VII with many discal setae; d-e. pleurotergites (d) T. trehernei, rows without microtrichias (e) T. origani, rows with microtrichias, f-h forewings setae distribution (f) T. origani, (g) T. australis (h) T. trehernei; i-k antenna, number of segments and colour (i) T. origani (j) T. trehernei (k) T, simplex, antenna 8-segmented.

Specimens of thrips were collected in tubes containing 100 % ethanol. The species were recognized using morphological characters observable under a stereoscopic microscope at 160x magnification. Specimens were preserved in a freezer at -20 ºC until the moment of their use. DNA extraction was performed following the protocol proposed by Rugman et al. (2006) and modified by Kadirvel et al. (2013). A whole specimen was placed in a

1.5 ml Eppendorf tube with 100 µl of TNES (50 mM Tris [pH: 7.5], 400 mM NaCl, 20 mM EDTA, and 0.5 % SDS) and ground with the help of a plastic tip. The ground-down tissue was transferred to a 0.5 ml Eppendorf tube and 0.85 µl of proteinase K (20 mg/ml) was added. The sample was then incubated in a bath at 37 ºC for 18 h. The protein was precipitated with the addition of 28 µl of 5 M NaCl and centrifuged for 5 min at 13,000 rpm. The supernatant was transferred to a new 0.5 ml Eppendorf tube, one volume of

100 % ethanol previously chilled in a freezer at -20 ºC was added, and the tube incubated for one hour at room temperature. A precipitation step was done by centrifugation for 5 min at 13,000 rpm. The supernatant was discarded, 200 µl of 70 % ethanol was added to wash, and another centrifugation was carried out for 5 min at 13,000 rpm. The supernatant was carefully discarded, and the pellet was allowed to air dry. Once dry, the DNA was resuspended in 20 µl of sterile water and stored in a freezer at -20 ºC until PCR was carried out. The following primers were used: forward C1-J-1718 GGAGGATTTGGAAATTGATTAGTTCC and reverse C1-N-2329: ACTGTAAATATATGATGAGCTCA, cited by Simon et al. (1994), to obtain the partial sequence of the mitochondrial COI gene. A total volume of 40 µl PCR reagents was used, containing a 4 µl sample with 10 ng/µl DNA, 4 µl 1X PCR buffer, 1µl MgCl2 [50 mM], 0.6 µl [10 µM], dNTPS, 0.4 µl [100 µM] of forward and reverse primers and 0.3 µl Platinum Taq polymerase, and 29 µl sterile distilled water. The PCR reaction was performed in an Eppendorf Mastercycler nexus model thermocycler. The program consisted of 94 ºC for 10 minutes, followed by 4 cycles of 94 ºC for 40 seconds, 45 ºC for 40 seconds, 72 ºC for 1 minute, then 35 cycles of 94 ºC for 40 seconds, 51 ºC for 40 seconds, 72 ºC for 1 minute, and finally 15 minutes at 72 ºC. A 1 % agarose gel (TBE) was run at 90 volts for 30 minutes to confirm the amplification of the fragment sought and bands of approximately 650 bp were visualized, using a 100 bp ladder (InvitrogenTM) as marker. The positive samples were purified according to the manufacturer's protocol with a Qiagen purification kit (QIAquick PCR Purification Kit), and they were sent to the laboratory of the Genomics Unit, Institute of Biotechnology, CICVyA - CNIA - INTA, where they were sequenced by capillary electrophoresis.

Fig. 3. Fig. 3. Maximum Likelihood phylogenetic tree (1000 bootstrap) obtained from COI gene partial sequences. Fig. 3. Maximum Likelihood phylogenetic tree (1000 bootstrap) obtained from COI gene partial sequences.

Table I. Table I. List of partial COI sequence codes used for construction of the phylogenetic tree, ordered by thrips species. Table I. List of partial COI sequence codes used for construction of the phylogenetic tree, ordered by thrips species. *

Code from GenBank or European Nucleotide Archives (ENA)

Four partial sequences contributed by us and deposited in the European Nucleotide Archives (ENA) and 25 obtained from GenBank (including three sequences for each biotype of T. tabaci , all available sequences of the genus Thrips tabaci filtered as cytochrome oxidase subunit I and Argentina, three sequences for T. simplex, three for T. trehernei and the only one available for T. australis) (Table I) were edited using BioEdit Sequence Alignment Editor (Hall, 1999) to conserve only the regions with good sequencing quality and that showed consensus in both directions. A BLASTN analysis (Zhang et al., 2000) was carried out using the consensus sequences of COI amplicon as query. Target sequences with the greatest similarity were retrieved from the GenBank database, and all taxa were aligned with ClustalW. Phylogenetic trees were constructed with MEGA11 software (Tamura et al., 2011). The evolutionary history was inferred using the Maximum Likelihood method based on the Tamura-Nei model (Tamura & Nei, 1993). The sequences were deposited in the EMBL-EBI database (PRJEB59814).

The phylogenetic tree for a partial sequence of cytochrome oxidase I, obtained for species of Thrips including those identified in Argentina up to May 23rd 2024 (Fig. 3) shows that both isolates of T. origani locate on the same clade distinct from T. tabaci (biotypes L1, L2 and T), T. australis, T. simplex and T. trehernei sequences, but show similarity (0.99) with one specimen classified as T. tabaci (sequence code in GenBank, MG334456). This sequence differs by more than 10 % from other T. tabaci COI sequences (598 sequences available in GenBank), which suggests a possible misidentification of a T. origani specimen labelled as having been collected in Canada.

The presence of T. origani in Argentina was reported to Sistema Nacional de Vigilancia y Monitoreo (SINAVIMO) of Servicio Nacional de Sanidad y Calidad Agroalimentaria (SENASA), Identificaction number 1306.