Taxonomía y sistemática
A new Pilogalumna (Acari: Oribatida: Galumnidae) from Mexico
Una nueva Pilogalumna (Acari: Oribatida: Galumnidae) de México
A new Pilogalumna (Acari: Oribatida: Galumnidae) from Mexico
Revista mexicana de biodiversidad, vol. 86, no. 3, 2015
Instituto de Biología
Received: 23 May 2014
Accepted: 11 March 2015
Abstract: A new species of Pilogalumna from the Ecological Reserve Pedregal de San Ángel, Mexico City is described from adult specimens of both sexes, this being the eighth Galumnidae species recorded from Mexico. Pilogalumna rosauraruizae sp. nov. is characterized by a combination of lamellar setae longer than other prodorsal setae, sensillum lanceolated with capitulum slightly barbulated, postanal porose area present, pseudolamellae absent, and 20 setae on the first tarsus. Additionally, the 18S rRNA partial sequence is reported, and an identification key for worldwide species of this genus is provided.
Keywords: Taxonomy, Morphology, Taxonomic key, 18S rRNA.
Resumen: Se describe una nueva especie de Pilogalumna de la Reserva Ecológica del Pedregal de San Ángel, Distrito Federal, México, a partir de ejemplares adultos de ambos sexos, siendo la octava especie de Galumnidae registrada para México. Pilogalumna rosauraruizae sp. nov. se caracteriza por la combinación de la seda lamelar más larga que las demás sedas prodorsales, sensilo lanceolado con capítulo ligeramente barbulado, área porosa postanal presente, ausencia de seudolamela y 20 sedas en el primer tarso. Adicionalmente, se registra la secuencia parcial 18S rRNA y se proporciona una clave de identificación para las especies del género en el mundo.
Palabras clave: Taxonomía, Morfología, Clave taxonómica, 18S rRNA.
Introduction
Galumnidae (Jacot, 1925) includes 34 genera, 9 subgenera, 470 species, and 33 subspecies worldwide (Subías, 2014). Nevertheless, only 7 species in 6 genera have been cited from Mexico (Palacios-Vargas & Iglesias, 2004), of which only 2 (Villagomez & Palacios-Vargas, 2013; Wharton, 1938) were described from Mexican specimens. Pilogalumna was erected by Grandjean (1956), with the type species P. ornatulaGrandjean, 1956. Currently this genus comprises 11 valid species and 6 subspecies (Subías, 2014); however, an updated taxonomic revision is needed.
The most detailed descriptions were done by Engelbrecht (1972a, 1972b) for P. bloemfonteinensis , P. kimberleyensis , and P. variabilis from South Africa. Nevin (1975) described P. cozadensis from the United States of America, performed a simple analysis that suggested that P. binadalares is a valid species, and gave measurements for several members of the genus. Finally Liu and Wu (2013) described P. minima from China including leg chaetotaxy.
Subías (2014) reported P. ornatula ornatulaGrandjean, 1956 from the Mediterranean region and also from Mexico. In the original description (Grandjean, 1956), it is mentioned that this species is distributed only in France and Spain. All the synonyms of this species (Galumna adareataMihelčič, 1957, Galumna decipiensMihelčič, 1956, Allogalumna molensisMihelčič, 1957, and Allogalumna pterataMihelčič, 1957) have been reported from Spain, mainly Madrid, Cercedilla, and Los Molinos (Mihelčič, 1956, 1957). Later, Vázquez and Prieto (2001) reported P. ornatula from Quintana Roo, Mexico for the first time.
In this work, we describe the 8 new species of winged mites from Mexico based on adult males and females. This contribution is the first to include the morphological description of a Galumnidae Oribatid mite along with its nuclear small subunit rRNA sequence (18S rDNA). This molecular marker has proven to be a good species identifier of mites along with Cytochrome c oxidase 1 and has been shown to resolve adequately the phylogenetic relationships of this group (Dabert, Witalinski, Kazmierski, Olszanowski, & Dabert, 2010). A taxonomic key for all species of the genus is also provided.
Materials and methods
During the study of temporal variation of community structure of soil microarthropods associated with Pittocaulon (Senecio ) praecox in El Pedregal de San Ángel Ecological Reserve, in southern México City (Razo-González, Castaño-Meneses, Callejas-Chavero, Pérez-Velázquez, & Palacios-Vargas, 2014), 61 specimens of a new species of Pilogalumna (Oribatei: Galumnidae) were found.
Mites were extracted from soil samples using Berlese-Tullgren funnels and preserved in 75% ethanol. Then they were mounted under slides in Hoyer's solution. Observations and measurements were made using a Carl Zeiss Axiostar Plus phase contrast microscope with a drawing tube adapted to the microscope. In the description, all measurements are in micrometers (μm) and indicated in brackets after each morphological character. Cheatotaxy follows Engelbrecht (1972), except for the adalar porose areas, which are named Aa1 and Aa2 , instead of Aai and Aae . Figures were edited in Photoshop CS5.
Extraction, amplification, and sequencing
Eight specimens were fixed in 96% ethanol and stored at −20 °C. DNA was extracted from a single specimen with a commercial kit using enzymatic methods and precipitation (MasterPure™ Complete DNA and RNA Purification Kit, Illumina Inc., Madison, WI, USA). DNA was amplified with VENTR™ DNA polymerase (New England Biolabs, Ipswich, MA, USA) and following the protocols suggested by Dabert et al. (2010), with some modifications: 6 μl (0.06 unit/μl) of Red Taq Ready Mix, 2 μl (10 μM) of the forward primer Fw1230 (5′ TGAAACTTAAAGGAATTGACG 3′), 2 μl (10 μM) of the reverse primer Rev18S (5′ TGATCCTTCCGCAGGTTCACCT 3′), and 2 μl of the purified DNA sample were used. Final extracts were 25 μl with a total DNA concentration of ≥100 ng per 25 μl. PCR cycling parameters included 35 cycles of denaturation at 94 °C for 45 s, annealing at 54 °C for 45 s, and extension at 72 °C for 90 s. Sequencing reactions were performed with BigDye Terminator v. 3.1 reagents (Life Technologies, Foster city, California, USA). The final product was sequenced with an Applied Biosystems® 3500xL Dx Genetic Analyzer (Life Technologies™ Foster City, CA, USA) at the Laboratorio de Secuenciación Genómica de la Biodiversidad y de la Salud, Instituto de Biología, Universidad Nacional Autónoma de México. The sequences were edited using BioEdit v7.2.5. software (Hall, 1999).
The partial 18S rRNA sequence of 686 base pairs for this new species was deposited in GenBank (Accession number KJ423065). It will be used for future analysis of the phylogeny of Galumnidae.
Description
Pilogalumna Grandjean, 1956
Type species . Pilogalumna ornatula
Diagnosis
Prodorsal lines L and S lacking; with true porose areas; 10 pairs of notogastral setae that might be reduced to alveouli; dorsosejugal suture interrupted, setae ta and marginal p1-3 always present; pteromophs never foveolate, with a notch and setae ta usually well developed; lamellar setae between lines L ; notogaster rounded, never foveolate; adanal lyrifissures adjacent to genital plate margins; tridactylus legs (Balogh, 1958; Balogh & Balogh, 1992).
P. rosauraruizae sp. nov. (Figs. 1-14).




Adult . (N = 10). Length 650 (621-709), width 483 (453-512). Color from dark brown to reddish brown.
Sensillum clavate, with capitulum barbulated. Cuticular ornamentation slightly punctate on prodorsum, notogaster and ventral plate. All prodorsal setae present and slightly barbulate, interlamellar setae short and erect; all notogastral porose area present, Aa duplicate; 10 pairs of short notogastric setae; no dorsosejugal suture, no median pore; 6 pairs of genital setae, 2 pairs of anal setae; lyrifissure iad close to anal plate; 1 pair of aggenital and 3 pairs of adanal setae; postanal porose area present; no ornamentation on genital and anal plates; no gastronotic or ventral granular belt.
Prodorsum (Figs. 1, 3 and 4). Surface slightly punctuated, no dorsosejugal suture, lines L and S lacking, dorsosejugal porose area (Ad ) (15 × 13) oval and smaller than notogastric porose areas. All prodorsal setae present and slightly barbulate (Fig. 9) interlamellar setae (in ) short and erect (54), lamellar setae (la ) longer than others (91), rostral setae (ro ) of average size (76) but more curved.
Key for the species of Pilogalumna (males and females).
Sensillum (SS) (85) slightly curved (Figs. 1, 3, 4 and 9), stalk thin and the insertion in the shape of "S", capitulum fusiform, thick close to apical region, with barbulations and punctuations. Chelicerae normal (185 length and 69 width) (Fig. 8), setae cha (49) longer than chb (37), both very barbulated.
Notogaster (Figs. 1 and 4). Integument slightly punctate from middle to posterior region, fine irregular ornamentation between Aa1 and A1 ; 10 pairs of setae (20, except ta ) in normal position, no double alveoli, no medial pore; porose areas semicircular (except A3 ), with little variation in form to slightly oval. Aa divided in Aa1 (18 × 6) orientated to sagittal line and Aa2 (15 × 5), between them setae te , under it there are setae ti and ms , and between them the lyrifissure im .
Porose area A1 (22 × 12) semicircular, irregular ornamentation between setae ms and r3 in the posterior margin, A2 oval (15 × 8) posterior to r3 ; A3 oval (39 × 6) being the biggest and located between setae r1 and lyrifissure ip , anterior to setae p1 and p2 , setae p3 at the side at level of A2 .
Pteromorpha bilobed (325 × 217) (Fig. 6), with 3 types of ornamentation, slight and superficial at margin, also with some striations, profuse at middle region, with a granular ornamentation on most of the surface except margins; it has a central notch near articulation zone to notogaster; setae ta (18) anterior to notch and posterior lyrifissure ia directed slightly toward the hinge.
Ventral plate (Fig. 2). Integument finely punctated, epimeral setae 1b , 3a , 4a , and 3b present (17 μm); genital plates smooth (94 length × 103 width), 6 genital setae (23), 2 in the anterior margin of each plate and another in a slightly curved row; anal plate smooth (156 length × 131 width), 2 pairs of anal setae (23); 1 pair of aggenital setae (21); 3 pairs of adanal setae subequal in size (20), ad1 and ad2 inserted posterior to anal plate, ad3 in the medial zone, anteriorly lyrifissure iad ; postanal porose area present, elongated (74 × 9), irregular shape, only visible at posterolateral view in a caudal preparation (Fig. 5).
Lateral region (Fig. 4). Lines L and S absent, in between position of lines L , circumpedal line present, thin, posterior to fourth acetabulum, rostrum slightly sharp.
Hypostome (Fig. 7). 165 length × 197 width. One pair of hypostomal setae (h ) thin and barbed (20), camerostoma with setae a (32) slightly longer than m (29), or1 and or2 (13) short and barbulated.
Pedipalp (Fig. 10). Setal formula 9-3-1-2. Femur with 2 setae, ventral longest, genua with only setae l′ , tibia with 3 setae, only v ventral, tarsus with 1 pair of ventral setae, 1 pair of lateral setae and the culminal (cm ), anteroculminal eupatidium (acm ) fused to solenidum ω .
Legs . All the legs are tridactylous with small punctuation on femora.
Chaetotaxy . (Table 1) Leg I (Fig. 11) setae l″ shorter than l′ on femur; solenidium σ on genua similar to ω2 of tarsus; φ1 on tibia dorsal, about twice the length of φ2 ; l′ of tibia as long as solenidium φ1 ; fastigial setae ft″ of tarsus short and thin, anterior to ω1 , ω2 about half the size of φ1 ; famulus (¿ ) very short and blunt tip; setae Ad″ and Ad′ Present. Leg II (Fig. 12), setae l″ and l′ of femur similar in length and shape, slightly barbulate; solenidium σ of genua similar to leg I; tibial φ long; ω1 and ω2 of tarsus similar in length and shape, with blunt tips. Leg III (Fig. 13) solenidium σ shorter than those of legs I and II ; φ about 3 times as long as σ . Leg IV (Fig. 14). Only 1 solenidium, φ on tibia, ventral tibial v″ shorter and more barbulate than v′ .
| Pilogalumna rosauraruizae sp. nov.Pilogalumna ornatulaGrandjean, 1965 | ||||
| Setal formulae. Fe: 4-4-2-2; Ge: 3-3-1-2; Ti: 4-4-3-3; Ta: 20-15-15-12 | ||||
| Solenidial formulae. Fe: 0-0-0-0; Ge: 1-1-1-0; Ti: 2-1-1-1; Ta: 2-2-0-0 | ||||
| Leg I | d , v , (l ) | l″ , v , d , σ | (l ), (v ), φ1 , φ2 | (ft ), ¿ , (tc ), (it ), (p ), (u ), (a ), s , (pv ), (Ad ), (pl ), ω1 , ω2 |
| Leg II | d , v , (l ) | l″ , v , d , σ | (l ), (v ), φ | (ft ), (tc ), (it ), (p ), (u ), (a ), s , (pv ), ω1 , ω2 |
| Leg III | d , v | l″ , σ | l′ , (v ), φ | (ft ), (tc ), (it ), (p ), (u ), (a ), s , (pv ) |
| Leg IV | d , v | (l ) | l′ , (v ), φ | ft″ , (tc ), (p ), (u ), (a ), s , (pv ) |
| Pilogalumna bloemfonteinensis Engelbrecht, 1972 | ||||
| Pilogalumna cozadensisNevin, 1975 | ||||
| Setal formulae. Fe: 4-4-2-2; Ge: 3-3-1-2; Ti: 4-4-3-3; Ta: 19-15-15-12 | ||||
| Solenidial formulae. Fe: 0-0-0-0; Ge: 1-1-1-0; Ti: 2-1-1-1; Ta: 2-2-0-0 | ||||
| Leg I | Tarsi lacking Ad″ | |||
| Pilogalumna variabilis Engelbrecht, 1972 | ||||
| Setal formulae. Fe: 4-3-2-2; Ge: 3-2-1-2; Ti: 4-4-2-3; Ta: 19-15-15-12 | ||||
| Solenidial formulae. Fe: 0-0-0-0; Ge: 1-0-1-0; Ti: 2-1-1-1; Ta: 2-2-0-0 | ||||
| Leg I | Tarsi lacking Ad″ | |||
| Leg II | Femur lacking l″ ; genua lacking d and solenidia σ | |||
| Leg III | Tibia lacking v″ | |||
Taxonomic summary
Type locality . Ecological Reserve Pedregal de San Ángel, Universidad Nacional Autónoma de México (UNAM), Distrito Federal, Mexico. 19°19′07.44″ N, 99°11′43.85″ W, 2330 m.a.s.l.
Type material . Female holotype deposited as slide, 09/05/2008, Mexico. Distrito Federal. Reserva Ecológica del Pedregal de San Ángel, Ciudad Universitaria. E. Catalán y F. Villagomez Coll., (catalog number #1555); 40 more paratypes with same data, of which 10 are deposited as slides (7 females, 3 males) and 30 in ethanol (22 females, 8 males) at 75% (# 1556); 11 specimens as additional material from type locality with collecting data 28/07/2013 (# 1554). This material is deposited in the collection of Laboratorio de Ecología y Sistemática de Microartrópodos (LESM), Facultad de Ciencias, UNAM. Additionally, 5 paratypes (catalog numbers CNAC00 9002 to CNAC00 9006) with the same data as the other paratypes, are deposited as slides in the Colección Nacional de Ácaros (CNAC), Instituto de Biología, UNAM.
Distribution . This species is only known from the type locality.
Etymology . This new species is dedicated to Dr. Rosaura Ruiz Gutiérrez, Director of the Facultad de Ciencias, UNAM, for supporting the development of science in Mexico.
Natural history . The specimens were collected from soil and litter under shrubs and small trees of Senecio (Pittocaulon ) praecox .
Remarks
Setal and solenidial morphology of legs provide important information for the identification of Pilogalumna species as suggested by Nevin (1975) and Engelbrecht (1972). Nevertheless, there is a lack of information for most of the species, as only 5 of 11 valid species (Subías, 2014) have detailed leg chaetotaxy reported (Engelbrecht, 1972a, 1972b; Grandjean, 1956; Liu & Wu, 2013; Nevin, 1975). Tarsi I vary from 19 to 20 setae, and tibiae of legs III can present 2 or 3 setae, genua of legs II also have 2 or 3 setae, and femora II 3 or 4 setae. This variation in the number of setae on leg articles has been overlooked, but it is important, as in P. variabilis Engelbrecht, 1972, that possesses a unique leg chaetotaxy. The morphology of solenidia might be relevant as well. It is a character that has been found to be variable between species and could be used for species discrimination.
P. rosauraruizae sp. nov. is very similar to P. ornatula but differs in lacking the pordorsal pseudolamela between la setae, the position of setae ti , and lirifisure im in the same axis between Aa2 and A1 . Presence of postanal porose area elongated as long as ventral plate, but never threefold longer. Finally, P. rosauraruizae sp. nov. is smaller, reaching a maximum of 709 in adults, while P. ornatula can reach a maximum of 735 in males and 770 in females. The new species differs from P. binadalares in the shape of sensillus and vertex. Leg chaetotaxy is also different from P. variabilis , P. cozadensis , and P. bloemfonteinensis , which have 19 setae on tarsus I, versus 20 setae in P. rosauraruizae sp. nov.
Acknowledgments
The authors thank Dr. Gabriela Castaño Meneses for donation of the mites (project PAPIIT-IN208508, DGAPA, UNAM). Dr. Hugo H. Mejía-Madrid provided financial and technical support (Project PAPIIT IA 202713-2, DGAPA, UNAM) for the molecular analyses and reviewed the manuscript. M.Sc. Laura M. Márquez Valdelamar (Instituto de Biología, UNAM), M.Sc. Andrea R. Jiménez Marín (Instituto de Biología, UNAM), and M.Sc. Fabiola Ramírez (Facultad de Ciencias, UNAM) provided technical assistance for molecular sequencing and amplification techniques. Dr. Roy A. Norton shared important literature for this study. This work is part of a master's thesis on the species delimitation in Galumnidae Oribatid mites from Mexico, where the relationships between species and genera within the family are being described. We thank to the Posgrado en Ciencias Biológicas, UNAM and Conacyt for the scholarship received.
References
Balogh, 1958 J. Balogh. Oribatides nouvelles de l’ Afrique tropicale. Revue de Zoologie et de Botanique Africaines. 1958; 58:1p
Balogh and Balogh, 1992 J. Balogh, P. Balogh. Budapest: Hungarian National Museum Press; 1992.
Dabert et al., 2010 M. Dabert, W. Witalinski, A. Kazmierski, Z. Olszanowski, J. Dabert. Molecular phylogeny of acariform mites (Acari, Arachnida): Strong conflict between phylogenetic signal and long-branch attraction artifacts. Molecular Phylogenetics and Evolution. 2010; 56:222p
Engelbrecht, 1972a C.M. Engelbrecht. Ctenogalumna moresonensis sp. n. and Pilogalumna bloemfonteinensis sp. n., two new South African species of the subfam. Allogalumninae Balogh, 1960 (Galumnidae, Oribatei). Acarologia. 1972; 14:497p
Engelbrecht, 1972b C.M. Engelbrecht. Galumnids from South Africa (Galumnidae, Oribatei). Acarologia. 1972; 14:109p
Grandjean, 1956 F. Grandjean. Galumnidae sans carénes lamellaires (Acariens, Oribates) 1re. Série. Bulletin de la Société Zoologique de France. 1956; 81:134p
Hall, 1999 T.A. Hall. BioEdit: A user-friendly biological alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series. 1999; 41:95p
Liu and Wu, 2013 D. Liu, D. Wu. Oribatid mites from Wanda mountains in China, with description of a new species of the genus Pilogalumna. International Journal of Acarology. 2013; 39:412p
Mihelčič, 1956 F. Mihelčič. Oribatiden Süderopas IV. Zoologischer Anzeiger. 1956; 156:205p
Mihelčič, 1957 F. Mihelčič. Oribatiden Süderopas VIII. Zoologischer Anzeiger. 1957; 159:101p
Nevin, 1975 F.R. Nevin. Pilogalumna cozadensis, a new species of galumnid from Nebraska, USA. Acarologia. 1975; 18:751p
Palacios-Vargas and Iglesias, 2004 J.G. Palacios-Vargas, R. Iglesias. Oribatei (Acari). Biodiversidad, taxonomía y biogeografía de artrópodos de México: hacia una síntesis de su conocimiento. México, D.F.: Universidad Nacional Autónoma de México, México; 2004. 431p
Razo-González et al., 2014 M. Razo-González, G. Castaño-Meneses, A. Callejas-Chavero, D. Pérez-Velázquez, J.G. Palacios-Vargas. Temporal variations of soil arthropods community structure in El Pedregal de San Ángel Ecological Reserve, Mexico City, Mexico. Applied Soil Ecology. 2014; 83:88p
Subías, 2014 L.S. Subías. Listado sistemático, sinonímico y biogeográfico de los ácaros oribátidos (Acariformes: Oribatida) del mundo (excepto fósiles). Graellsia. 2014; 60:3p
Vázquez and Prieto, 2001 G.M.M. Vázquez, D. Prieto. Oribatida. Fauna edáfica de las selvas tropicales de Quintana Roo. Chetumal: Universidad de Quintana Roo; 2001. 71p
Villagomez and Palacios-Vargas, 2013 F. Villagomez, J.G. Palacios-Vargas. A new species of Trichogalumna (Acari: Oribatida: Galumnidae) from Mexico. Brenesia. 2013; 79:72p
Wharton, 1938 G.W. Wharton. Acarina of Yucatan Caves. Baltimore: Carnegie Institution of Washington; 1938.
Notes
Author notes
Corresponding author.lfvillagomez@gmail.com