Abstract: Objective. It was to detect the circulation of microorganisms of the family Anaplasmataceae in a canine albergo of the municipality of Caldas Materials and methods. In view of the above, a descriptive study was conducted in 46 dogs (Canis lupus familiaris) to evaluate the presence of Ehrlichia spp. and Anaplasma spp. by molecular techniques or by immunodiagnostic, in a dog shelter of the municipality of Caldas. The DNA extraction was done in whole blood samples with EDTA. Primers were used against dsb and groEL genes to detect Ehrlichia and Anaplasma sequences respectively and phylogenetic analyzes of the sequences obtained were also carried out. On the other hand, SNAP 4DX® was used for serodiagnosis. Results. In the molecular testing, five positive samples were obtained for the Ehrlichia test and three for the Anaplasma test. In the serological tests, three individuals were positive for Ehrlichia spp., three for Anaplasma spp. and for the other trials measured by the SNAP (Dirofilaria immitis y Borrelia burgdorfe) the result was negative Conclusions. It demonstrated the circulation of Ehrlichia canis and Anaplasma platys in a dog shelter of the municipality of Caldas, Antioquia.
Keywords:AnaplasmaAnaplasma,diagnosisdiagnosis,Ehrlichia canisEhrlichia canis,PCRPCR,serology (Source:CAB)serology (Source:CAB).
Resumen: Objetivo. Fue detectar la circulación de microorganismos de la familia Anaplasmataceae en un alberge canino del municipio de Caldas. Materiales y métodos. Se realizó un estudio descriptivo en 46 perros (Canis lupus familiaris) para evaluar por técnicas moleculares o por inmunodiagnóstico la presencia de Ehrlichia spp. y Anaplasma spp., en un albergue canino del município de Caldas. Se hizo extracción de ADN en muestras de sangre entera con EDTA y se utilizaron cebadores contra los genes dsb y groEl, para detectar secuencias de Ehrlichia y Anaplasma respectivamente y análisis filogenéticos de las secuencias obtenidas. Por otro lado se usó el SNAP 4DX® para el serodiagnóstico. Resultados. En las pruebas moleculares se obtuvieron cinco muestras positivas para Ehrlichia y tres para Anamaplasma. En las pruebas serológicas, tres individuos fueron positivos para Ehrlichia spp., tres para Anaplasma spp. y negativos para los demás ensayos medidos por el SNAP (Dirofilaria immitis y Borrelia burgdorferi).Conclusiones. Se demostró la circulación de Ehrlichia canis y Anaplasma platys en un albergue del municipio de Caldas, Antioquia.
Palabras clave: Anaplasma, diagnóstico, Ehrlichia canis, PCR, serología (Fuente: CAB).
Artículos
Identification of bacteria from the Anaplasmataceae family in dog shelter of the municipality of Caldas, Antioquia
Identificación de bacterias de la familia Anaplasmataceae en un albergue canino del municipio de Caldas, Antioquia
Received: 09 November 2016
Accepted: 20 February 2017
hrlichia and Anaplasma are baceteria genus with some species bearing a zoonotic character. Such genuses belong to the Rickettsia order (Anaplasmataceae family) and transmitted by vectors (ticks and fleas) (1,2).
The Ehrlichia genus is comprised by six species, E. canis, E. chaffeensis, E. ewingii, E. muris, E. mineirensis and E. ruminantium (3). All species of Ehrlichia infect vertebrate hosts, and all of them are transmitted by ticks. E. chaffeensis and E. ewingii are demonstrated agents in clinical human cases in North America, while E. canis, E. ruminantium, and E. ewingii are pathogens mainly with vertrinary relevance (4). The species recognized in the Anaplasma genus are A. phagocytophilum, A. platys (previously Ehrlichia platys), A. marginale (A. marginale subespecies centrale), A. bovis (previously E. bovis), A. caudatum, and A. ovis (3). A. phagocytophilum infects humans and many animal species producing different diseases known as human granulocytic anaplasmosis (HGA; formerly known as human granulocytic ehrlichiosis), canine granulocytic anaplasmosis (formerly known as canine granulocytic ehrlichiosis), and equine granulocytic anaplasmosis (formerly known as equine granulocytic ehrlichiosis). Dog platelets are the target cells of A. platys, causing canine cyclic thrombocytopenia, while A. marginale, A. bovis, and A. ovis infect the erythrocytes of domestic and wild ruminants (4). Frequency and experimental studies have demonstrated infection with an acute disease and changes in hematological values by different agents of the anaplasmataceae family (Ehrlichia canis, Ehrlichia chaffeensis, Anaplasma platys and Anaplasma phagocytophilum) in dogs (5,6). In Colombia, different species of microorganisms of the family Anaplasmataceae have been detected in ticks collected in domestic animals (7).
There is a growing interest in detection of these microorganisms due to their negative effects on human and domestic canine health, especially in the life cycle of these pathogens in abandonment conditions. Due to its geographic location, reservoir diversity, vectors, and mainly tropical weather conditions, Colombia gathers all the conditions that favor vector dissemination (8).Diseases casued by bacteria of the Ehrlichia and Anaplasma genuses may evolve similarly to other febrile pathologies in dogs, and therefore many of them may remain undiagnosed or misdiagnosed. The purpose of this work was to detect the circulation of Anaplasmataceae microorganisms in a dog shelter in the municipality of Caldas.
Geographic areas of study. Samples were collected from dogs living in a dog shelter in Caldas, Antioquia, La Miel Township, 3 km away from the urban part, at an average altitude of 1,750 meters above sea level, and an average temperature of 19°C.
Samples. The sample collection, serological and molecular detection processes were carried out between March 2015 and March 2016. A descriptive study was made, using a sample (obtained for convenience) of 46 individuals out of a total 110 dogs. Two blood samples were taken from the cephalic vein, one in EDTA tubes and another one in tubes with no anticoagulant. Then, these samples were taken to the “Hno. Marco Antonio Serna f.s.c. Clinical Diagnostic Veterinary Laboratory” of Corporación Universitaria Lasallista (Lasallean University Corporation). Blood serum was separated in a centrifuge at 4000 rpm/10 minutes and all samples were stored at -20°C until the time of analysis. The study was approved by the animal experimentation ethics committee of Corporación Universitaria Lasallista, minute No. 8 of June 06, 2013.
Hemogram. In order to carry out the hemogram, we used whole blood with EDTA and the Abacus Junior Vet®, Diatron normalized hematologic analysis device.
DNA extraction. DNA was extracted from blood with EDTA using the Thermo Scientific tissue ADN purification® kit, following manufactured recommendations. Then we assessed the integrity of the DNA by electrophoresis and its quality by spectrophotometry. Then, DNA was stored at 4°C for 12 hours and then frozen at -20°C until its use in conventional PCR.
Molecular tests. The Polymerase Chain Reaction (PCR) was used. To diagnose bacteria of the Ehrlichia spp. Genus we used the dsb-330 (5’GATGATGTCTGAAGATATGAAACAAAT 3’) and dsb-728 (5’CTGCTCGTCTATTTTACTTCTTAAAGT 3’) primers, which amplify a 409-pb segment of the dsb (9). Thermal cycling conditions were 98°C for 5 minutes, followed by 40 cycles at 98°C for 15 seconds, 60°C for 30 seconds, and 72°C for 60 seconds, a final extension of 72°C for 5 minutes, and 4°C until verifying the reaction results in a gel.
For A. platys we used the pla-HS475F (5’AAGGCGAAAGAAGCAGTCTTA 3’) and pla-HS1198R (5’CATAGTCTGAAGTGGAGGAC 3’) primers, which amplify a 724-pb fragment of the groEl gene. Thermal cycling conditions were 95°C for 5 minutes, followed by 40 cycles at 95°C for 30 seconds, 58°C for 30 seconds, and 72°C for 90 seconds, with a final extension of 72°C for 5 minutes, and 4°C until verifying the reaction results in an Agarose gel (10,11). For both reactions, we used the PCR Phusion Green Hot Start II High-Fidelity DNA Polymerase (Thermo®) kit, which uses a final volume of 20µl/sample, obtaining the following concentrations: buffer 1x, 200µM of each dNTPs, 0.5 µM of each primer, 3% DMSO, and 0.02 U/µl of Taq polymerase.
In addition, one positive control and two negative controls were used for each test (one internal, where the mix is prepared, and one external, where DNA samples are mounted). All products were ran in a 2% agarose gel, using EZ-Vision (AMRESCO®) dye. The power source was set at 100 volts for 40 minutes and the visualization was made in an ENDUROTM (Labnet) documentation system. All products positive for Ehrlichia spp. and Anaplasma platys, were sent for sequencing to Macrogen Inc., Seoul-Korea, sequences were edited with DNAstar, and phylogenetic analysis were made using the MEGA 6.1 program (12).
Serological test (SNAP 4Dx). For the serological tests, we used the SNAP 4Dx (IDEXX®) kit to detect the Dirofilaria immitis (canine heartworm) antigen, antibodies against Anaplasma phagocytophilum, Anaplasma platys, Borrelia burgdorferi, Ehrlichia canis and Ehrlichia ewingii. Serum samples stored at -20°C were left at room temperature for 30 minutes, and after that time had elapsed, we carried out the tests following manufacturer recommendations (13).
We drew a clinical sheet for each animal, indicating general data (sex, age, breed). Out of the 46 animals in the study, 20 (43%) were male, and 26 (57%) were females. There was no characterization for breed, since they were all mixes. According to dental record aging, they were all adults.
Comparison of the hematological analysis of the red blood, white blood, and platelet samples with reference values of 97 healthy dogs with ages between 1 and 6 treated in the Veterinary Hospital of Universidad de Antioquia Between years 2007 and 2009 showed no abnormalities in any of the individuals (14).
We found that all extracted DNA samples assessed through electrophoresis showed a good integrity, and spectrophotometry showed an average concentration of 87 ng/µl and a 260-280 ratio averaging 1.75. The molecular tests for all 46 dogs showed three positive cases for A. Platys (two males and one female, subjects 7, 83 and 94); and five for E. canis (three females and two males, subjects 7, 16, 48, 62, and 63), accounting for 6.5% and 10.9% of the studies population, respectively (Table 1).

Out of the five products obtained through PCR for the Ehrlichia dsd gene, three were clear enough to be analyzed (subjects 7, 48, and 63). Identity and coverage results were analyzed in order to establish homologies with reference sequences. We then drew a phylogenetic tree with the Neighbor-Joining method, using a 1000 replication bootstrap and the P distance method to calculate evolutionary distance. The tree was rooted in its middle point and the results of this analysis show that the sequences found correspond to E. canis. With the results for the groEL gene, which are specific primers for A. platys, we were able to confirm these bacteria in one of the three obtained sequences (subject 7), since the other two results yielded very tenuous products and sequences had low quality (Figures 1 and 2).


The SNAP 4DX quick test showed four positive samples to the antigenic reaction: one female and one mal identified with numbers 16 and 62 reacted to Ehrlichia spp.; two females, identified as 7 and 42 reacted to Anaplasma spp.; and one more females, number 82, was positive for both agents. In general, we obtained a 605% (3/46) positivity for each bacterial agents. As a special piece of data, one female (number 7), was positive for Anaplasma spp. In serological and molecular tests, also showed positive for E. canis, but only in PCR. On the other hand, the results for the rest of the tests, D. immitis and B. burgdorferi, were negative, as shown in Table 1.
When comparing both types of tests, SNAP and PCR, we found that two subjects presented antibodies and sequences for E. canis, three more were positive through the molecular test but still had no antibodies detectable by the serological test and one more was positive in the serological test but had no detectable bacteria sequences through the molecular blood test. In the case of A. platys, the results were the following: one positive subject in both tests, two subjects were positive in the molecular test but negative in the serological test, and finally to more showed antibodies but were negative in the molecular test (Table 2).

According to the molecular results in this study, we found an 11% infection frequency of de E. canis in animals that were abandoned and rescued in peri-urban or rural areas. These results are lower than those found in a work carried out in the Department of Valle del Cauca, which showed a 54% of positive cases of de E. canis, probably because such study was carried out in a warmer area, where tick populations are usually greater and the methodology used is more sensitive (nested PCR) (15).
Positive results for Ehrlichia spp. through SNAP 4Dx (6.5%) were lower than those obtained in Ibagué (department of Tolima, Colombia), which showed an approximate 32% (16). Just as in the previous case, the study in Ibagué used a different serological test (indirect immunofluorescence or IFI), which demands higher skills to differentiate unspecific reactivity.
When comparing the molecular and serological results of this study, we found that out of the six positive subjects (Table 2), only two were congruent with the tests, and since they were clinically healthy animals, we may infer that the canine subjects were in a subacute stage of the infection. Three more animals were positive through PCR and negative to the serological test; these animals were probably in the initial stage of the infection, and this result highlights the importance of having an additional tool to diagnose the acute stage. Finally, one dog was positive in the serological test and negative in the molecular test, probably due to a past infection or for being in a chronic stage, where the bacteria settles in the spleen or bone marrow, but not in the bloodstream (17). Similar data was found in Wong et al (18) in 2011.
For A. platys we found a 6.5% molecular detection and 6.5% serological positivity. Asking the Ehrlichia detection test, we found one subject that was positive in both tests, two subjects positive only on the serological test, and two more individuals positive only for PCR. The result matches the previous studies made in canine subjects that also detected A. platys in Colombia (6); the results in the studies are highly relevant for veterinarians since their differential diagnosis should consider this agent.
On the other hand, when we analyzed the hematological insults, we found that the white cell line and the platelet line showed no abnormal values in positive subjects. During the study, the dogs showed an apparent good health condition, suggesting that despite the presence of Anaplasmataceae bacteria in positive subjects, bacterial loads were not high enough to produce some clinical condition. Finally, we highlight that molecular tests are a mystery tool to diagnose this type of infections of Anaplasmataceae microorganisms.
To COLCIENCIAS for financing the “Programa nacional para la investigación y desarrollo de productos veterinarios. Noanotecnología farmacéutica: una estrategia de innovación (National program for researching and developing veterinary products. Pharmaceutical nanotechnology: an innovation strategy)” project code 127556238833, in call 562–2012 “banco de proyectos I+D+I, programa nacional de biotecnología (I+D+I Project Bank, National Biotechnology Program)” with the support of Corporación Universitaria Lasallista; and to GENTECH as co-financiers. To the Hogar de Alicia animal welfare center, veterinarian Victor Molina, and all the membesrs of the Centauro group, and GIVET for their advice on lab essay setup.
pipelb@gmail.com



