INTRODUCTION

Mycobacterium avium subsp. paratuberculosis (MAP) is the causative agent of Johne’s disease (JD) in domestic and wild animals. In cows, it causes chronic enteritis, diarrhea, weight loss, and progressive emaciation or death. MAP transmission occurs by multiple routes, including fecal-oral, intrauterine, and through milk or colostrum. Infected cattle can shed bacteria in their feces and milk and spread the infection (Corbett et al., 2018; Wolf et al., 2014). MAP has also been linked to human Crohn’s disease, a systemic disorder that causes mainly a chronic inflammation of the intestine (Bull et al., 2003; Feller et al., 2007; Rhodes et al., 2014). Many researchers have shown that the animals with JD can excrete live MAP in milk (McAloon et al., 2016), being resistant to thermal processes (Grant, 2006; Slana et al. 2008). MAP has been isolated from pasteurized commercial milk in Argentina, Brazil, India, Italy, United Kingdom, United States and Czech Republic between 0.3% - 67% of milk samples; (Grant et al., 2002a; Grant et al., 2002b; Ellingson et al., 2005; Ayele et al., 2005; Shankar et al., 2010; Paolicchi et al., 2012; Carvalho et al., 2012; Serraino et al., 2017, Gerrard et al., 2018). Other researchers identified MAP in commercial dairy products like cheeses, yogurt and powder milk by culture and PCR (Hruska et al., 2005; Botsaris et al., 2010; Shankar et al., 2010). The survival of MAP to heat treatments is related to the initial number of live bacteria in raw milk. MAP has been detected after high temperature short-time pasteurization (HTST), if the initial number of viable bacteria was greater than 1 x 105 CFU.mL-1 (Gao et al., 2002). This survival has also been linked to the MAP forming clumps. For this reason, combining pasteurization with homogenization increases the effectiveness of the heat treatment (Grant et al., 2005; Hammer et al., 2014).

The number of bacteria present in food products reflects the sanitary conditions of processing and allows determining the preservation and consumption time (Pinzón Fernández, 2006). Milk is a complete food for its nutritional characteristics, and an ideal growing medium for a great variety of microorganisms. In raw milk, microorganisms with different metabolic characteristics are found. The most important quality indicator group is called Mesophilic Total Aerobic Bacteria (TAB) and the concentrations of these bacteria are applied as a quality standard in raw milk (Morton, 2001). Furthermore, some outbreaks of foodborne diseases have been linked to the consumption of commercial milk processed with deficient thermal treatment, post-pasteurization contamination or incorrect storage conditions (Swai et al., 2011). In Argentina, there are no data about the TAB counts on samples of pasteurized milk from retail shops.

Based on previous data (Paolicchi et al., 2012) were MAP was identified using a small sample size,the aims of this study were to identify the presence of MAP and other mycobacteria in retail milk, yogurts and cheeses by culture and PCR and to assess the quality of commercial milk through TAB counting.

MATERIALS AND METHODS

Samples

Simple random and purposive sampling methods were followed to select the study samples. The sample size was determined based on the expected prevalence from the published data and the desired precision of 5% at 95% confidence level. The sample size was calculated using the standard formula described by Thrusfield et al., (2005). During 2013 and 2014. For 24 months, 384 commercial milk samples from the Mar y Sierras Basin, Argentina were evaluated. Twenty-four samples (3 replicates for each variable) were taken according to the following variables: commercial brand (first quality and second quality, based on relation price-quality criteria), thermal treatment (ultra pasteurized (UP) and ultra high temperature (UHT)), fat content (whole and skim) and seasons (autumn/ winter and spring /summer). Three packs of 1L of commercial milk from each category were randomly taken from retail points.

For 12 months, 24 yogurt samples and 24 soft cheeses samples from Argentina, were evaluated. One pack of 1L of commercial yogurt and 1 pack of soft cheese from each category were randomly taken from retail points. Three samples of each category were analyzed, considering the following variables: commercial brand (first quality and second quality), fat content (whole and skim) and seasons (autumn –winter and spring – summer). All samples were carried to the laboratory at 4°C until the analysis.

Culture

The samples were processed without chemical decontamination. From each pack, 150 mL of milk were taken and centrifuged (centrifuge Sorvall RC5CE, Newtown, USA) at 9,400 rpm for 15 min at 10°C. The fat layer and the pellet were processed. The pellet was suspended in 3mL of PBS. Four drops were inoculated in each of the following culture media: Herrold’s egg yolk medium (HEYM), HEYM plus pyruvic acid (Sigma Chemical Co., St. Louis, Mo, USA.), HEYM plus antibiotics (vancomicin 0.01% w/v, amphotericin B 5% w/v, nalidixic acid 0.3% w/v y nistatin 0.01% w/v), Stonebrink and Löwenstein Jensen. The slopes were incubated at 37°C for 16 weeks and examined weekly for presence of MAP and mycobacteria colonies. Suspected colonies were analyzed microscopically using Ziehl Neelsen (ZN) stain (OIE, 2011).

PCR

DNA extraction by immunomagnetic beads (IMB): For identification of MAP by IS900-PCR 1 mL of the suspension obtained from each sample for culture was heated at 50°C during 15 min. Then each sample was centrifuged at 7,500 rpm at 4°C, during 15 min (Hermle, Z233MK-2, Germany). The milk fat and serum were discarded, and the precipitate was processed as follows: IMB coated with Goat Anti-Mouse IgG England, BioLabs, Inc., #S1431S, USA) were employed at 3.65 x 1010 IMB/mL, with adhesive capacity of 1 mg/5 µg of murine IgG. The suspension was homogenized by slow and constant agitation at 4°C during 1 h. In another tube, 10 µL of IMB mix (3.65 x 108) plus 10 µg/µL of polyclonal antibody - antiMAP was homogenized by slow and constant agitation at 4°C during 1 h. Then, the samples were collocated in a magnetic rack during 10 min. The complex IMB-Ac was obtained in the wall of the microtube, and the rest of the material was discarded. Afterwards, three washings with PBS were performed, separated with IMB and suspended in 100 µL of PBS.

DNA extraction by commercial kit: For Mycobacterium spp. detection by hsp65-PCR, 300 µL of the samples were taken. DNA was extracted using QIAamp™ DNA blood Mini Kit (Qiagen AG, Basel, Switzerland) following the manufacturer’s instructions. For IS900 identification, the DNAs obtained were amplified as follow: the mix was prepared with 10 L of green buffer (Promega, USA), 4 L of dNTPs (2.5 mM each) (ABGene, USA), 0.25 mM of Primer dir C (GATCGGAACGTCGGCTGGTCAGG), 0.25 mM of Primer rev C (GATCGCCTTGTCATCGCTGCCG) (Collins et al., 1993), 0.3 L of Taq polymerase, 28.7 L of distilled water and 5 L of DNA sample, final volume 50 L. The samples were amplified by touch down PCR technique (Zumarraga et al., 2005): briefly, initial melting to 96°C during 3 min, followed by 10 cycles of de 96°C, 1 min; the annealing of primers at 72°C, 1 min; decreasing 1°C per cycle and extension at 72°C, 1 min. This step was followed by 30 cycles of 96°C, 1 min; 62°C, 1 min and 72°C 1 min. Finally, one cycle of 72°C, 8 min for final extension. For each set of PCRs, a positive control (DNA of MAP) and a negative control (distilled water) were added. The amplified product was subjected to electrophoresis in agarose gel (2% w/w) and the DNA was visualized in blue light transilluminator with Sybr Safe™. A sample was considered as positive if a 217bp amplified product was obtained.

For Mycobacterium spp. identification the sequence hsp65 was amplified using the same described mix but using 2 different primers: TB11 (ACCAACGATGGTGTGTCCAT) and TB12 (CTTGTCGAACCGCATACCCT) (Telenti et al., 1993). The samples were amplified as follow: 45 cycles of 96°C, 1 min; 56°C, 1 min and 72°C 1 min; and a final extension of 72°C, 8 min. For each set a positive control (DNA of mycobacteria) and negative control (sterile distilled water) were included. The amplified product was subjected to electrophoresis in agarose gel and the DNA was visualized in blue light transilluminator with Sybr Safe™. A sample was considered as positive if a 440bp amplified product was obtained.

TAB count

Each container was manually shaken and disinfected externally with 70% ethanol. One mL of each sample was taken to perform the TAB count according to the standard of International Dairy Federation FIL-IDF 100B-1991 (FIL-IDF, 1991). Serial dilutions of the samples were made (1:10, 1:100 y 1:1000) in peptone water (5% w/w) (Oxoid, England). Then, 1 mL of each dilution was spread onto 2 Petri plates where it was mixed with 15 mL of liquid Plate Count Agar (PCA, Oxoid, England) at 45°C. Once the agar had solidified, the plates were incubated for 48 ± 3 h at 37°C. The CFU counts was performed in those plates with 10 and 300 colonies. The average number of CFUs of both plates corresponding to the same dilution was multiplied by the inverse of the dilution factor to estimate the initial TAB CFU. According to Alimentary Argentinian Code (AAC), UP and UAT milk must meet the following requirements: TAB count less than 1000 CFU.mL-1 and less than 100 CFU.mL-1 (acceptable quality, followed by 7 days incubation at 35-37°C) of milk, respectively (articles 559tris and 560). Considering these limits, the samples were classified as “Not apt for consumption” or “Apt for consumption”.

Identification of isolated bacteria

From PCA culture plates used for TAB counts, 3 bacterial colonies were randomly selected and purified on Columbia Blood Agar (Oxoid, England) for subsequent identification through biochemical testing.

Statistical analysis

For IS900-PCR results and TAB counts the data were analyzed using a model of multivariable logistic regression (Proc. LOGISTIC, SAS Studio v3.6, SAS Institute Inc., Cary, NC). The statistical analysis of the IS900-PCR and TAB counts was performed to evaluate the association of the different categories of the selected factors on these results. The response variable was positive or negative IS900-PCR and the presence/absence of TAB counts above the limits established by the AAC. The explicative variables were season (autumn – winter/ spring- summer), fat content (whole / skim), the brand (first /second) and the heat treatment (UP/UHT). The variables that showed a value p≤0.10 in the univariate analyses were included in a final multivariate model. The relative risk of exceeding the limits established by the AFC was estimated by calculating the odds ratio (OR) for each of the variables included in the model.

RESULTS

Detection of MAP and mycobacteria

All retail milk and milk products samples were negative for Mycobacterium spp. cultures. Using IS900-PCR for MAP detection, it was found that 6/384 (1.56%) samples of commercial milk were positive (table 1 and figure 1). The samples of commercial yogurts and cheeses were negative for IS900-PCR. All the samples of milk, yogurts and cheeses were negative for detection of hsp65-PCR gen for identification of Mycobacterium spp.

TAB count

Twenty-four milk samples (6.25%) were not apt for consumption exceeding the limits established by the AAC. Sixteen of these samples (4.17%) were UHT. Also, considering the totality of not apt for consumption, 23 (5.99%) samples corresponded to the second brand commercial milks. The greatest number of samples that exceeded the limits established by the AAC was taken during Spring – Summer (table 2 and figure 2).

Identification of bacteria

Colonies extracted from the plates of counts were identified as belonging to Flia. Enterobacteriaceae and the following genera: Staphylococcus sp., Flavobacterium sp., Aeromonas sp., Bacillus sp., Kurthia sp.

Statistical analysis

For IS900-PCR results no significant effect between variables was observed (p>0.10) (table 1 and figure 1). For TAB count, a significant effect of the time of year and commercial brands was observed (p<0.01). No significant effect of fat content or interactions between variables was observed (p>0.10) (table 2 and figure 2).

DISCUSSION

All cultures were negative indicating that there were no viable mycobacteria in the samples of milk and milk products selected for this study, in contrast with other researchers who isolated MAP from commercial pasteurized milk and dairy products (Grant et al., 2002a; Grant et al., 2002b; Ellingson et al., 2005; Ayele et al., 2005; Shankar et al., 2010; Hruska et al., 2005, Carvalho et al., 2012; Paolicchi et al., 2012; Serraino et al., 2017; Gerrad et al., 2018). The surveys for MAP identification in retail milk show that pasteurization is not efficient to inactivate all MAP cells present in raw milk. The samples with a load of mycobacteria under the detection limit would result negatively. Besides, MAP is forming clumps is not uniformly distributed in different matrices like milk products (Grant et al., 2002c). Other factors that are affecting the MAP isolation could be genetic differences between MAP strains, effect of decontaminating agents, and interference of other microorganisms that compete with MAP during the incubation (Dundee et al., 2001; O´Reilly et al., 2004, Carvalho et al., 2012). All these factors could contribute to obtaining false negative cultures of mycobacteria. Given that low numbers of MAP are likely to survive pasteurization, testing as large a volume of milk as possible should increase the chances of detecting surviving MAP (Serraino et al., 2017). Besides, in comparison, other studies in which MAP was successfully isolated from retail milk have used high quality nutrient and more sensitive culture media (Grant et al., 2002; Grant et al., 2002b; Ellingson et al., 2005; Ayele et al., 2005).

The IS900-PCR for MAP detection was positive in 1.56% (6/384) of the milk samples, while all the samples of commercial yogurt and cheeses were negative. No significant effect of the variables was observed (p>0.10). MAP has been detected by PCR between 3% and 15.5% (Anzabi and Hanifian, 2012; Carvalho et al., 2009; Gao et al., 2002; Grant et al., 2002; Millar et al., 1996). In Iran, 10.7% of commercial milk samples were positive to PCR (Anzabi and Hanifian, 2012) and In the United Kingdom, 7.05% (Millar et al., 1996) but not by culture. The MAP-positive samples would also include samples where DNA from inactivated cells were detected, explaining the high prevalence reported in these studies (Gerrard et al., 2018).

In the present study, MAP and mycobacteria were neither detected in samples of commercial cheeses nor yogurts, suggesting that pasteurized milk or dairy products are not a significant source of mycobacteria for consumers. In similar studies carried out in commercial cheeses, MAP was detected between 4% and 50% of the samples by PCR (Ikonomopoulos et al., 2005; Farias et al., 2014) and between 3-4% by culture (Ikonomopoulos et al., 2005; Farias et al., 2014). On the other hand, the MAP search was only carried out by Shankar et al. (2010), who isolated MAP from 5/9 (56%) milk samples.

Regarding TAB counts, we found that 6.25% of the milk samples exceeded the limits established by the AAC (AAC, 1992). These positive commercialized milk samples could be inefficiently processed or improperly stored, being not suitable for human consumption. A significant effect of the season was observed, being more likely to find samples that exceed the AAC limits from Spring-Summer than Winter-Autumn. There was also a significant effect of the brand on the TAB count, finding that second brand or lower quality products had significantly higher TAB counts than the first brand milk (OR=25.9) (figure 2 B). These results agreed with Freitas et al. (2009), who evaluated TAB counts in milks marketed in Brazil, finding that lower quality brands presented higher counts. The genus of bacteria identified in dairy products are environmental microorganisms indicating that the contamination of the samples could be originated during the elaboration and storage of the products.

CONCLUSIONS

All samples were negative for mycobacteria culture, which could indicate that there were not viable mycobacteria or that their concentration was low in the dairy product studied. The PCR for MAP identification was positive for 1.56% of commercial milk samples indicating that the milk came from dairy farms with JD. The absence or low levels of mycobacteria in pasteurized milk, suggests that pasteurized milk or dairy products are not a significant source of mycobacteria to consumers. We found milk samples that exceed the limits established by the AAC for TAB counts. A large number of samples should be analyzed to confirm the correct processing of retail milk. Emphasis should be placed on the sanitary control of diseases caused by bacteria in dairy herds as well as in dairies, with the aim of protecting consumers against the possible risk of infection with potentially pathogenic bacteria.

Acknowledgments

The authors thank Dr. Yosef Huberman (INTA Balcarce, Argentina) for editing this manuscript. This study was funded by INTA (projects PNSA 1115052 and PNSA 1115054) and UNMdP (AGR 590/19).

REFERENCES

ANZABI, Y.; HANIFIAN, S. 2012. Detection of Mycobacterium avium subspecies paratuberculosis in pasteurized milk by IS900 PCR and culture method. Afr J of Microbiol Res 6: 1453-1456.

AYELE, W.; SVASTOVA, P.; ROUBAL, P.; BARTOS, M.; PAVLIK, I. 2005. Mycobacterium avium subsp. paratuberculosis cultured from locally and commercially pasteurized cow’s milk in the Czech Republic. Appl Environ Microbiol 71, 1210-1214.

BOTSARIS, G.; SLANA, I.; LIAPI, M.; DODD, C.; ECONOMIDES, C.; REES, C.; PAVLIK, I. 2010. Rapid detection methods for viable Mycobacterium avium sub-species paratuberculosis in milk and cheese. Int J Food Microbiol 141: S87-S90.

BULL, T.J.; MCMINN, E.J.; SIDI-BOUMEDINE, K.; SKULL, A.; DURKIN, D.; NEILD, P.; RHODES, G.; PICKUP, R.; HERMON-TAYLOR, J. 2003. Detection and verification of Mycobacterium avium subsp paratuberculosis in fresh ileocolonic mucosal biopsy specimens from individuals with and without Crohn’s disease. J Clin Microbiol 41: 2915-2923.

CARVALHO, A.; SILVA, A.; CAMPOS, V.; MOREIRA, M. 2009. Short communication: Detection of Mycobacterium avium subspecies paratuberculosis by polymerase chain reaction in bovine milk in Brazil. J of Dairy Sci 92: 5408-5410.

CARVALHO, I.; PIETRALONGA, P.; SCHWARZ, D.; FARIA, C.; MOREIRA, M. 2012. Short communication: Recovery of viable Mycobacterium avium subspecies paratuberculosis from retail pasteurized whole milk in Brazil. J Dairy Sci 95: 6946-6948.

CÓDIGO ALIMENTARIO ARGENTINO. 1992. (R 494, 1/7/94).

COLLINS, D.M.; STEPHENS, D.M.; DE LISLE, G.W. 1993. Comparison of polymerase chain reaction tests and faecal culture for detecting Mycobacterium paratuberculosis in bovine faeces. Vet Microbiol 36: 28899.

CORBETT, C.S.; BARKEMA, H.W.; DE BUCK, J. 2018. Quantifying fecal shedding of Mycobacterium avium ssp. paratuberculosis from calves after experimental infection and exposure. J Dairy Sci 101: 1478-1487.

DUNDEE, L.; GRANT, I.; BALL, H.; ROWE, M. 2001. Comparative evaluation of four decontamination protocols for the isolation of Mycobacterium avium subsp. paratuberculosis from milk. Lett Appl Microbiol 33: 173-177.

ELLINGSON, J.; ANDERSON, J.; KOZICZKOWSKI, J.; RADCLIFF, R.; SLOAN, S.; ALLEN, S.; SULLIVAN, N. 2005. Detection of viable Mycobacterium avium subsp. paratuberculosis in retail pasteurized whole milk by two culture methods and PCR. J Food Prot 68: 966-972.

FARIA, A.; SCHWARZ, D.; CARVALHO, I.; ROCHA, B.; DE CARVALHO CASTRO, K.; SILVA, M.; MOREIRA, M. 2014. Short communication: Viable Mycobacterium avium subspecies paratuberculosis in retail artisanal Coalho cheese from Northeastern Brazil. J Dairy Sci 97: 1-4.

FELLER, M.; HUWILER, K.; STEPHAN, R.; ALTPETER, E.; SHANG, A.; FURRER, H.; PFYFFER, G.E.; JEMMI, T.; BAUMGARTNER, A.; EGGER, M. 2007. Mycobacterium avium subspecies paratuberculosis and Crohn’s disease: a systematic review and meta-analysis. Lancet Infect Dis 7: 607-613.

FIL-IDF 100B-1991. 1991. Milk and milk products. Enumeration of microorganisms. Colony count technique at 30ºC. IDF Square Verote 41, B-100 Brussels, Belgium.

FREITAS, R.; NERO, L.; CARVALHO, A. 2009. Technical note: Enumeration of mesophilic aerobes in milk: Evaluation of standard official protocols and Petrifilm aerobic count plates. J Dairy Sci 92: 3069-3073.

GAO, A.; MUTHARIA, L.; CHEN, S.; RAHN, K.; ODUMERU, J. 2002. Effect of pasteurization on survival of Mycobacterium avium subsp. paratuberculosis in milk. J Dairy Sci 85: 3198-3205.

GERRARD, Z.E.; SWIFT, B.C.; BOTSARIS, G.; DAVIDSON, R.S.; HUTCHINGS, M.R.; HUXLEY, J.N.; RESS, C.E.D. 2018. SURVIVAL OF MYCOBACTERIUM AVIUM SUBSPECIES PARATUBERCULOSIS IN RETAIL PASTEURISED MILK. FOOD MICROBIOL 74: 57–63. DOI: 10.1016/J.FM.2018.03.004

GRANT, I.; HITCHINGS, E.; MCCARTNEY, A.; FERGUSON, F.; ROWE, M. 2002a. Effect of commercial-scale high-temperature, short-time pasteurization on the viability of Mycobacterium paratuberculosis in naturally infected cows’ milk. Appl Environ Microbiol 68: 602-607.

GRANT, I.; BALL, H.; ROWE, M. 2002b. Incidence of Mycobacterium avium subsp. paratuberculosis in bulk raw and commercial pasteurized cow’s milk from approved dairy processing establishments in the United Kingdom. Appl Environ Microbiol 68: 428-2435.

GRANT, I.; BALL, H.; ROWE, M. 2002c. Effectiveness of milk pasteurization in relation of Mycobacterium paratuberculosis. Res Vet Sci 2: 72, 29.

GRANT, I. 2005. Zoonotic potential of Mycobacterium avium subsp. paratuberculosis: the current position. J Appl Microbiol 98: 1282-1293.

GRANT, I. 2006. Mycobacterium avium subsp. paratuberculosis in foods: current evidence and potential consequences. Inter J of Dairy Tech 59: 112-117.

HAMMER, P.; KIESNER, C.; WALTE, H. 2014. Effect of homogenization on heat inactivation of Mycobacterium avium subespecies paratuberculosis in milk. J of Dairy Sci 97: 2045-2048.

HRUSKA, K.; BARTOS, M.; KRALIK, P.; PAVLIK, I. 2005. Mycobacterium avium subsp. paratuberculosis in powdered infant milk: paratuberculosis in cattle- the public health problem to be solved. Vet Med-Czech 50: 327-335.

IKONOMOPOULOS, J.; PAVLIK, I.; BARTOS, M.; SVASTOVA, P.; AYELE, W.; ROUBAL, P. 2005. Detection of Mycobacterium avium subsp. paratuberculosis in retail cheeses from Greece and Czech Republic. Appl Environ Microbiol 71: 8934-8936.

MCALOON, C.G.; WHYTE, P.; MORE, S.J.; GREEN, M.J.; O’GRADY, L.; GARCIA, A.; DOHERTY, M.L. 2016. The effect of paratuberculosis on milk yield—A systematic review and meta-analysis. J Dairy Sci 99: 1449-1460.

MILLAR, D.; FORD, J.; SANDERSON, J.; WITHEY, S.; TIZARD, M.; DORAN, T.; HERMON-TAYLOR, J. 1996. IS900 PCR to detect Mycobacterium paratuberculosis in retail supplies of whole pasteurized cows’ milk in England and Wales. Appl and Environ Microbiol 62: 3446-3452.

MORTIER, R.A.; BARKEMA, H.W.; DE BUCK, J. 2015. Susceptibility to and diagnosis of Mycobacterium avium subspecies paratuberculosis infection in dairy calves: A review. Preventive veterinary medicine 121: 189-198.

MORTON, D. 2001. Aerobic Plate Count. In: DOWNES, F.P.; ITO, K. (eds.). Compendium of Methods for Microbiological Examination of Foods. American Public Health Association, Washington, USA. 63-68 pp.

O´REILLY, C.; O›CONNOR, L.; ANDERSON, W.; HARVEY, P.; GRANT, I.; DONAGHY, J.; ROWE, M.; O›MAHONY, P. 2004. Surveillance of bulk raw and commercially pasteurized cow’s milk from approved Irish liquid-milk pasteurization plants to determine the incidence of Mycobacterium paratuberculosis. Appl Environ Microbiol 70: 5138-5144.

PAOLICCHI, F.; CIRONE, K.; MORSELLA, C.; GIOFREÉ, A. 2012. First isolation of Mycobacterium avium subsp. paratuberculosis from commercial pasteurized milk in Argentina. Braz J Microbiol 1034-1037.

PINZÓN FERNÁNDEZ, A. 2006. Determinación del índice de bacterias mesófilas aerobias versus leche pasteurizada que se comercializan en la zona urbana de la ciudad de Popayán. Tesis Doctoral, Universidad Nacional Abierta y a Distancia, Facultad de Ciencias Agrarias, Popayán, Colombia.

RHODES, G.; RICHARDSON, H.; HERMON-TAYLOR, J.; WEIGHTMAN, A.; HIGHAM A.; PICKUP, R. 2014. Mycobacterium avium subspecies paratuberculosis: human exposure through environmental and domestic aerosols. Pathogens 3: 557-595.

SAS INST. INC., C., NC. 1998. Statistical Analysis System. SAS User’s Guide: Statistics.

SHANKAR, H.; SINGH, S.; SINGH, P.; SINGH, A.; SOHAL, J.; GREENSTEIN, R. 2010. Presence, characterization, and genotype profiles of Mycobacterium avium subspecies paratuberculosis from unpasteurized individual and pooled milk, commercial pasteurized milk, and milk products in India by culture, PCR and PCR- REA methods. Int J Infect Dis 14: 121-126.

SLANÁ, I. 2011. Paratuberculosis (Johnes’s disease). In: Manual de las Pruebas de Diagnóstico y de las Vacunas para los Animales Terrestres. OIE.

SLANA, I.; PAOLICCHI, F.; JANSTOVA, B.; NAVRATILOVA, P.; PAVLIK, I. 2008. Detection methods for Mycobacterium avium subsp. paratuberculosis in milk and milk products: a review. Vet Medicina 53: 286-306.

SERRAINO, A.; BONILAURI, P.; GIACOMETTI, F.; RICCHI, M.; CAMMI, G.; PIVA, S.; ZAMBRINI, V.; CANEVER, A.; ARRIGONI, N. 2017. Short communication: Investigation into Mycobacterium avium ssp. paratuberculosis in pasteurized milk in Italy. J Dairy Sci 100: 118-123.

SWAI, E.; SCHOONMAN, L. 2011. Microbial quality and associated health risk of raw milk marketed in the Tanga region of Tanzania. Asian Pacific J of Tropical Biomedicine 1: 217-222.

TELENTI, A.; MARCHESI, F.; BALZ, M.; BALLY, F.; BÖTTGER, E.C.; BODMER, T. 1993. Rapid identification of mycobacteria to the species level by poly- merase chain reaction and restriction enzyme analysis. J Clin Microbiol 31:175-8. doi: 10.1128/JCM.31.2.175-178.1993

WOLF, R.; CLEMENT, F.; BARKEMA, H.W.; ORSEL, K. 2014. Economic evaluation of participation in a voluntary Johne’s disease prevention and control program from a farmer’s perspective.The Alberta Johne’s Disease Initiative. J Dairy Sci 97: 2822-2834.

THRUSFIELD, M. 2005. Veterinary epidemiology. 2nd Edition, Blackwell Science, Oxford, 117-198.

ZUMÁRRAGA, M.; MEIKLE, V.; BERNARDELLI, A.; ABDALA, A.; TARABLA, H.; ROMANO, M.; CATALDI, A. 2005. Use of touch-down polymerase chain reaction to enhance the sensitivity of Mycobacterium bovis detection. J Vet Diagn Invest 17: 232-238.